Open Access

VacA, cagA, iceA and oipA genotypes status and antimicrobial resistance properties of Helicobacter pylori isolated from various types of ready to eat foods

Annals of Clinical Microbiology and Antimicrobials201615:2

https://doi.org/10.1186/s12941-015-0115-z

Received: 7 October 2015

Accepted: 23 November 2015

Published: 20 January 2016

Abstract

Background

Despite the high clinical standing of Helicobacter pylori, its exact routes of transmission and origin have not been determined. Based on the contentious hypothesis, foods play an important roles in the transmission of H. pylori to humans. The present study was carried out to investigate the vacA, cagA, oipA and iceA genotypes status of H. pylori isolated from the various types of ready to eat foods.

Methods

A total of 550 ready to eat food samples were cultured and tested. H. pylori-positive strains were analyzed for the presence of various genotypes and antimicrobial resistance pattern.

Results

Seventy four out of 550 (13.45 %) samples were positive for H. pylori. Olvie salad (36 %), restaurant salad (30 %), fruit salad (28 %) and soup (22 %) were the most commonly contaminated. H. pylori strains harbored the highest levels of resistance against amoxicillin (94.59 %), ampicillin (93.24 %), metronidazole (89.18 %) and tetracycline (72.97 %). The most commonly detected genotypes were vacA s1a (78.37 %), vacA m2 (75.67 %), vacA m1a (51.35 %) and cagA (41.89 %). The prevalence of iceA1, iceA2 and oipA genotypes were 13.51, 4.05 and 18.91 %, respectively. S1am2 (70.27 %), s1am1a (39.18 %) and m1am2 (31.08 %) were the most commonly detected combined genotypes. Of 40 different genotypic combinations, s1a/cagA+/iceA1/oipA− (12.16 %), s1a/cagA+/iceA1/oipA+ (10.81 %) and s1a/cagA−/iceA1/oipA+ (10.81 %) were the most prevalent.

Conclusions

The present investigation showed that some types of ready to eat food samples maybe the sources of resistant and virulent strains of H. pylori. Warily use of antibiotics with respect to the results of disk diffusion method and careful health monitoring on food and staffs of food producing companies maybe reduce the risk of H. pylori in foods.

Keywords

Helicobacter pylori Genotypes Genotyping Ready to eat foods

Background

Ready to eat foods play an important roles in the nutrition of Iranian people. Every day millions of people use from ready to eat foods in their main meals. Therefore, hygienic quality of ready to eat foods is extremely important regarding public health hazards.

Helicobacter pylori (H. pylori) is a microaerophilic gram-negative bacterium which is known as the causative agent of peptic ulcer disease, type B gastritis, gastric adenocarcinoma and mucosa-associated lymphoid tissue lymphoma [1]. It has been estimated that 17–86 % of hospitalized patients with peptic ulcers were infected with H. pylori [13].

The role of foods in the transmission of H. pylori is still unknown but there were several investigations which focused on the identification of this bacterium in various types of food samples [48]. Good conditions for the growth of bacteria in various types of foods cause it to be survive [6, 8].

To appraise the pathogenicity of H. pylori, evaluation of latent virulence factors and genotypes is essential. The most commonly important virulence factors among H. pylori strains of different clinical outcomes of human and animal beings are the vacuolating cytotoxin (vacA), induced by contact with the epithelium antigen (iceA), cytotoxin associated gene (cag) and outer inflammatory protein (oip) [6, 9, 10]. These genes are usually induced adhesion and invasion to the gastric epithelial cells [11, 12]. The vacA belongs to the group of genes with variable genotypes or structures. This gene is associated with injury to epithelial cells. The vacA gene is polymorphic, comprising variable signal regions (type s1 or s2) and mid-regions (type m1 or m2). The s1 type is further subtyped into s1a, s1b and s1c subtypes and the m1 into m1a and m1b subtypes. The mosaic combination of s and m-region allelic types determines the particular cytotoxin and consequently, the pathogenicity of the bacterium [11, 13]. The iceA gene has two main allelic variants iceA1 and iceA2 but their functions are not yet clear. Cag pathogenicity island (PAI) has been shown to be involved in persuading inflammation, ulceration and carcinogenesis [12]. The cagA gene has been detected in the specimens taken from the severe cases of peptic ulcer [812]. The oipA gene plays a significant role in effective colonization of mucosa [812]. Genotyping using these virulence markers is considered as one of the best approaches for study of correlations between H. pylori isolates from different samples.

Data on the epidemiology and transmission of H. pylori is extremely significant in order to prevent its distribution and to identify high-risk populations, especially in areas that have high rates of gastritis, peptic ulcers and gastric cancer such as Iran [610, 13]. Considering the unclear epidemiological aspects of H. pylori in ready to eat foods and according to the high prevalence of H. pylori all-around the world, the present investigation was carried out in order to study the exact status of vacA, cagA, iceA and oipA genotypes and antibiotic resistance pattern of H. pylori isolated from various types of ready to eat food samples.

Methods

Sample collection

From December 2013 to May 2014, overall 550 ready to eat food samples including cream-candy (n = 50), traditional bread (n = 50), sausage (n = 50), salami (n = 50), hamburger (n = 50), soup (n = 50), restaurant salad (n = 50), falafel (n = 50), olvie salad (n = 50), chicken nugget (n = 50) and fruit salad (n = 50) were purchased from the supermarkets of Isfahan province, Iran. Samples (100 mL, in sterile glass containers) were transported to the laboratory at 4 °C. All samples were kept under refrigeration in plastic bags; information about dates of production and of assigned shelf lives was not presented.

Isolation of Helicobacter pylori

Twenty five milliliters of each homogenized sample were added to 225 mL of Wilkins Chalgren anaerobe broth (Oxoid, UK) supplemented with colistin methanesulfonate (30 mg/L) and 5 % of horse serum (Sigma, St. Louis, MO, USA) and nalidixic acid (30 mg/L), vancomycin (10 mg/L) cycloheximide (100 mg/L) and trimethoprim (30 mg/L) (Sigma, St. Louis, MO, USA) and incubated for 7 days at 37 °C with shaking under microaerophilic conditions. Then, 0.1 mL of the enrichment selective broth was plated onto Wilkins Chalgren anaerobe agar (Oxoid, UK) supplemented with 5 % of defibrinated horse blood and 30 mg/L colistin methanesulfonate, 100 mg/L cycloheximide, 30 mg/L nalidixic acid, 30 mg/L trimethoprim, and 10 mg/L vancomycin (Sigma, St. Louis, MO, USA) and incubated for 7 days at 37 °C under microaerophilic conditions. For comparison, a reference strain of H. pylori (ATCC 43504) was employed.

DNA extraction and Helicobacter pylori 16S rRNA gene amplification

Suspected colonies were identified as H. pylori based on the PCR technique. Genomic DNA was extracted from the colonies with typical characters of H. pylori using a DNA extraction kit for cells and tissues (Roche Applied Science, Germany, 11814770001) according to the manufacturer’s instructions and its density was assessed by optic densitometry. Extracted DNA was amplified for the 16S rRNA gene (primers: HP-F: 5′-CTGGAGAGACTAAGCCCTCC-3′ and HP-R: 5′-ATTACTGACGCTGATTGTGC-3′) [14]. PCR reactions were performed in a final volume of 50 µL containing 5 µL 10 × buffer + MgCl2, 2 mM dNTP, 2 unit Taq DNA polymerase, 100 ng genomic DNA as a template, and 25 pmol of each primer. PCR was performed using a thermal cycler (Eppendorf Co., Germany) under the following conditions: an initial denaturation for 2 min at 94 °C; 30 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s and a final extension at 72 °C for 8 min.

Antimicrobial susceptibility testing

Pure cultures of H. pylori were applied for antibiotic susceptibility test. One strain from each H. pylori-positive sample was selected for this aim. Antimicrobial susceptibility test was accomplished by the Kirby-Bauer disc diffusion method using Mueller–Hinton agar (Merck, Germany) supplemented with 5 % defibrinated sheep blood and 7 % fetal calf serum, according to the Clinical Laboratory Standards Institute [15]. The antimicrobial resistance of H. pylori was measured against the widely used antibiotics in cases of H. pylori gastric ulcer. The following antimicrobial disks (HiMedia Laboratories, Mumbai, India) were used: ampicillin (10 µg), metronidazole (5 µg), erythromycin (5 µg), clarithromycin (2 µg), amoxicillin (10 µg), tetracycline (30 µg), levofloxacin (5 µg), streptomycin (10 µg), rifampin (30 µg), cefsulodin (30 µg), trimethoprim (25 µg), furazolidone (1 µg) and spiramycin (100 µg). After incubation at 37 °C for 48 h in a microaerophilic atmosphere, the susceptibility of the H. pylori was measured against each antimicrobial agents. Results were construed in accordance with interpretive criteria provided by CLSI (2012) [15]. The H. pylori ATCC 43504 was used as quality control organisms in antimicrobial susceptibility determination.

Genotyping of vacA, cagA, iceA and oipA genes of Helicobacter pylori

Presence of the oipA, cagA and the genotypes of vacA (s1a, s1b, s1c, m1a, m1b and m2) and iceA (iceA1 and iceA2) alleles were determined using PCR technique. List of primers is shown in Table 1 [12, 1621].
Table 1

Oligonucleotide primers used for genotyping of Helicobacter pylori strains isolated from ready to eat food samples

Genes name

Primer Sequence (5′–3′)

Size of product (bp)

vacA s 1 a

F: CTCTCGCTTTAGTAGGAGC

R: CTGCTTGAATGCGCCAAAC

213

vacA s 1 b

F: AGCGCCATACCGCAAGAG

CTGCTTGAATGCGCCAAAC

187

vacA s 1 c

F: CTCTCGCTTTAGTGGGGYT

R: CTGCTTGAATGCGCCAAAC

213

vacA s 2

F: GCTAACACGCCAAATGATCC

R: CTGCTTGAATGCGCCAAAC

199

vacA m 1 A

F: GGTCAAAATGCGGTCATGG

R: CCATTGGTACCTGTAGAAAC

290

vacA m 1 B

F: GGCCCCAATGCAGTCATGGA

R: GCTGTTAGTGCCTAAAGAAGCAT

291

vacA m 2

F: GGAGCCCCAGGAAACATTG

R: CATAACTAGCGCCTTGCA

352

cag A

F: GATAACAGCCAAGCTTTTGAGG

R: CTGCAAAAGATTGTTTGGCAGA

300

iceA 1

F: GTGTTTTTAACCAAAGTATC

R: CTATAGCCASTYTCTTTGCA

247

iceA 2

F: GTTGGGTATATCACAATTTAT

R: TTRCCCTATTTTCTAGTAGGT

229/334

oip A

F: GTTTTTGATGCATGGGATTT

R: GTGCATCTCTTATGGCTTT

401

The PCR were performed in a total volume of 50 μl containing 1 μM of each primers, 1 μL of genomic DNA (approximately 200 ng), 1 mM of dNTPs mix (invitrogen), 2 mM of Mgcl2, and 0.05 U/μL Taq DNA polymerase (invitrogen). PCR amplifications were performed in an automated thermal cycler (Biometra Co., Germany). The following cycle conditions were used for PCR amplification: for vacA: 32 cycles of 45 s at 95 °C, 50 s at 64 °C, and 70 s at 72 °C; for cagA: 1 min at 94 °C, 1 min at 56 °C, and 1 min at 72 °C; for iceA: 1 min at 94 °C, 1 min at 56 °C, and 1 min at 72 °C and finally, for oipA: 1 min at 94 °C, 1 min at 56 °C and 1 min at 72 °C. All runs included one negative DNA control consisting of PCR grade water and two or more positive controls (26695, J99, SS1, Tx30, 88–23 and 84–183).

Gel electrophoresis

The PCR amplification products (10 μl) were subjected to electrophoresis in a 1.5 % agarose gel in 1X TBE buffer at 80 V for 30 min, stained with ethidium bromide, and images were obtained in a UVIdoc gel documentation systems (UK). The PCR products were identified by 100 bp DNA size marker (Fermentas, Germany).

Statistical analysis

Data were transferred to Microsoft Excel spreadsheet (Microsoft Corp., Redmond, WA, USA) for analysis. Using SPSS 16.0 statistical software (SPSS Inc., Chicago, IL, USA), Chi square test and Fisher’s exact two-tailed test analysis was performed and differences were considered significant at values of P < 0.05. Distribution of H. pylori genotypes isolated from food stuffs were statistically analyzed.

Results

Prevalence of Helicobacter pylori in various types of ready to eat food samples

All of the ready to eat food samples were examined using the culture and PCR techniques. Table 2 shows the total distribution of H. pylori in the ready to eat food samples. Of 550 ready to eat food samples, 74 (13.45 %) were positive for H. pylori. The most commonly contaminated samples were olvie salad (36 %), restaurant salad (30 %), fruit salad (28 %) and soup (22 %). There were no positive results for sausage, salami and chicken nugget. There were statistically significant differences amongst the incidence of bacteria in hamburger and olvie salad (P = 0.027), traditional bread and restaurant salad (P = 0.033) and soup and falafel (P = 0.041).
Table 2

Distribution of Helicobacter pylori in various types of ready to eat food samples

Types of samples

No. samples collected

Positive results for H. pylori (%)

Cream-candy

50

9 (18)

Traditional bread

50

3 (6)

Sausage

50

Salami

50

Hamburger

50

1 (2)

Soup

50

11 (22)

Restaurant salad

50

15 (30)

Falafel

50

3 (6)

Olvie salad

50

18 (36)

Chicken nugget

50

Fruit salad

50

14 (28)

Total

550

74 (13.45)

Antimicrobial susceptibility pattern

Antimicrobial susceptibility of H. pylori isolates of ready to eat food samples is shown in Table 3. H. pylori strains showed the highest levels of resistance against amoxicillin (94.59 %), ampicillin (93.24 %), metronidazole (89.18 %) and tetracycline (72.97 %) antibiotics. There were significant difference between the levels of antibiotic resistance and sources of H. pylori strains (P = 0.039). There were statistically significant differences in the levels of antibiotic resistance between amoxicillin and spiramycin (P = 0.015), ampicillin and spiramycin (P = 0.018), metronidazole and furazolidone (P = 0.023), tetracycline and furazolidone (P = 0.027), amoxicillin and furazolidone (P = 0.025), metronidazole and rifampin (P = 0.031), ampicillin and erythromycin (P = 0.026) and amoxicillin and cefsulodin (P = 0.022).
Table 3

Antimicrobial resistance pattern of Helicobacter pylori isolates of ready to eat food samples

Types of samples (no. positive results)

Pattern of antibiotic resistance (%)

AM10

Met5

ER5

CLR2

AMX 10

Tet30

Lev5

S10

RIF30

Cef30

TRP25

FZL1

Spi100

Cream-candy (9)

8 (88.88)

9 (100)

6 (66.66)

4 (44.44)

8 (88.88)

7 (77.77)

3 (33.33)

3 (33.33)

2 ()

3 (33.33)

5 (55.55)

1 (11.11)

1 (11.11)

Traditional bread (3)

3 (100)

3 (100)

2 (66.66)

1 (33.33)

3 (100)

2 (66.66)

1 (33.33)

1 (33.33)

1 (33.33)

1 (33.33)

1 (33.33)

Hamburger (1)

1 (100)

1 (100)

1 (100)

1 (100)

1 (100)

1 (100)

Soup (11)

10 (90.90)

10 (90.90)

6 (54.54)

5 (45.45)

10 (90.90)

8 (72.72)

4 (36.36)

3 (27.27)

3 (27.27)

3 (27.27)

6 (54.54)

2 (18.18)

1 (9.09)

Restaurant salad (15)

13 (86.66)

13 (86.66)

8 (53.33)

6 (40)

14 (93.33)

10 (66.66)

5 (33.33)

4 (26.66)

4 (26.66)

4 (26.66)

7 (46.66)

4 (26.66)

2 (13.33)

Falafel (3)

3 (100)

3 (100)

2 (66.66)

1 (33.33)

3 (100)

2 (66.66)

2 (66.66)

1 (33.33)

1 (33.33)

1 (33.33)

2 (66.66)

1 (33.33)

Olvie salad (18)

16 (88.88)

16 (88.88)

10 (55.55)

9 (50)

17 (94.44)

13 (72.22)

6 (33.33)

5 (27.77)

5 (27.77)

6 (33.33)

10 (55.55)

6 (33.33)

3 (16.66)

Fruit salad (14)

13 (92.85)

12 (85.71)

8 (57.14)

11 (78.57)

14 (100)

11 (78.57)

6 (42.85)

5 (35.71)

5 (35.71)

4 (28.57)

8 (57.14)

5 (35.71)

2 (14.28)

Total (74)

69 (93.24)

66 (89.18)

43 (58.10)

34 (45.94)

70 (94.59)

54 (72.97)

27 (36.48)

23 (31.08)

21 (28.37)

22 (29.72)

40 (54.05)

19 (25.67)

9 (12.16)

AM10 ampicillin (10 µg), Met5 metronidazole (5 µg), ER5 erythromycin (5 µg), CLR2 clarithromycin (2 µg), AMX10 amoxicillin (10 µg), Tet30 tetracycline (30 µg), Lev5 levofloxacin (5 µg), S10 streptomycin (10 µg), RIF30 rifampin (30 µg), Cef30 cefsulodin (30 µg), TRP25 trimethoprim (25 µg), FZL1 furazolidone (1 µg) and Spi100 spiramycin (100 µg)

Distribution of Helicobacter pylori genotypes

Distribution of vacA, cagA, iceA and oipA genotypes of the H. pylori strains of ready to eat food samples is shown in Table 4. We found that the most commonly detected genotypes were vacA s1a (78.37 %), vacA m2 (75.67 %), vacA m1a (51.35 %) and cagA (41.89 %). Total prevalence of iceA1, iceA2 and oipA genotypes were 13.51, 4.05 and 18.91 %, respectively. Significant differences were found between the incidence of s1a and s1c (P = 0.028) and also between s1a and s2 (P = 0.021), s1a and m1b (P = 0.019), m2 and s1c (P = 0.023), m1a and m1b (P = 0.024), m2 and s2 (P = 0.030), m2 and m1b (P = 0.036), iceA1 and iceA2 (P = 0.042) and cagA and oipA (P = 0.037) genotypes. Fifteen different genotypic combinations were detected in the H. pylori isolates of ready to eat food samples (Table 5). The most commonly detected combined genotypes were s1am2 (70.27 %), s1am1a (39.18 %) and m1am2 (31.08 %). There were no positive results for m1bs2 genotype. Significant differences were found between the incidence of s1am2 and s1am1b (P = 0.025), s1am2 and s1cm1b (P = 0.039), s1am1a and s2m2 (P = 0.041), s1am2 and m1bm2 (P = 0.043), m2s1a and iceA1iceA2 (P = 0.025).
Table 4

Distribution of various genotypes in Helicobacter pylori strains of ready to eat food samples

Types of samples (no. positive results)

Distribution of vacA, cagA, iceA and oipA genotypes (%)

S1a

S1b

S1c

S2

M1a

M1b

M2

CagA

IceA1

IceA2

OipA

Cream-candy (9)

7 (77.77)

3 (33.33)

1 (11.11)

4 (44.44)

2 (22.22)

7 (77.77)

1 (11.11)

2 (22.22)

3 (33.33)

Traditional bread (3)

2 (66.66)

1 (33.33)

2 (66.66)

1 (33.33)

Hamburger (1)

1 (100)

1 (100)

Soup (11)

11 (100)

4 (36.36)

2 (18.18)

1 (9.09)

4 (36.36)

3 (27.27)

10 (90.90)

9 (81.81)

3 (27.27)

1 (9.09)

4 (36.36)

Restaurant salad (15)

10 (66.66)

4 (26.66)

3 (20)

2 (13.33)

8 (53.33)

1 (6.66)

11 (73.33)

2 (13.33)

2 (13.33)

1 (6.66)

3 (20)

Falafel (3)

2 (66.66)

1 (33.33)

1 (33.33)

1 (33.33)

1 (33.33)

Olvie salad (18)

16 (88.88)

5 (27.77)

4 (22.22)

2 (11.11)

13 (72.22)

2 (11.11)

15 (83.33)

15 (83.33)

2 (11.11)

1 (5.55)

2 (11.11)

Fruit salad (14)

9 (64.28)

3 (21.42)

3 (21.42)

1 (7.14)

7 (50)

10 (71.42)

1 (7.14)

1 (7.14)

2 (14.28)

Total (74)

58 (78.37)

20 (27.02)

13 (17.56)

6 (8.10)

38 (51.35)

8 (10.81)

56 (75.67)

31 (41.89)

10 (13.51)

3 (4.05)

14 (18.91)

Table 5

Distribution of combined genotypes of Helicobacter pylori isolated from ready to eat foods

Genotypes

Prevalence (%)a

M1as1a

29 (39.18)

M1as1b

12 (16.21)

M1bs1a

4 (5.40)

M1bs1b

2 (2.70)

M1as1c

3 (4.05)

M1bs1c

1 (1.35)

M2s1a

52 (70.27)

M2s1b

11 (14.86)

M2s1c

6 (8.10)

M2s2

1 (1.35)

M1as2

1 (1.35)

M1bs2

M1am2

23 (31.08)

M1bm2

2 (2.70)

CagA+

31 (41.89)

CagA−

43 (58.10)

IceA1

10 (13.51)

IceA2

3 (4.05)

IceA1 IceA2

1 (1.35)

OipA+

14 (18.91)

OipA−

60 (81.08)

aFrom a total of 74 positive strains of H. pylori

Distribution of combined genotypes

Forty different genotypic combinations were detected in the H. pylori strains of food stuffs (Table 6). The most commonly detected combined genotypes were s1a/cagA+/iceA1/oipA− (12.16 %), s1a/cagA+/iceA1/oipA+ (10.81 %), s1a/cagA−/iceA1/oipA+ (10.81 %), s1b/cagA+/iceA1/oipA− (9.45 %), m2/cagA+/iceA1/oipA+ (9.45 %), m2/cagA+/iceA1/oipA− (9.45 %), m2/cagA−/iceA1/oipA+ (9.45 %) and m2/cagA−/iceA1/oipA− (9.45 %).
Table 6

Combined vacA, cagA, iceA and oipA genotypes of Helicobacter pylori isolated from ready to eat food samples

Combined genotypes

Total distribution (%)a

s1a/cagA+/iceA1/oipA+

8 (10.81)

s1b/cagA+/iceA1/oipA+

5 (6.75)

s1c/cagA+/iceA1/oipA+

2 (2.70)

s1a/cagA+/iceA2/oipA+

1 (1.35)

s1b/cagA+/iceA2/oipA+

s1c/cagA+/iceA2/oipA+

s1a/cagA−/iceA1/oipA+

8 (10.81)

s1b/cagA−/iceA1/oipA+

6 (8.10)

s1c/cagA−/iceA1/oipA+

2 (2.70)

s1a/cagA−/iceA2/oipA+

1 (1.35)

s1b/cagA−/iceA2/oipA+

s1c/cagA−/iceA2/oipA+

s1a/cagA+/iceA1/oipA−

9 (12.16)

s1b/cagA+/iceA1/oipA−

7 (9.45)

s1c/cagA+/iceA1/oipA−

3 (4.05)

s2/cagA+/iceA1/oipA+

3 (4.05)

s2/cagA+/iceA2/oipA+

s2/cagA−/iceA1/oipA+

4 (5.40)

s2/cagA−/iceA2/oipA+

s2/cagA−/iceA2/oipA−

s2/cagA+/iceA2/oipA−

1 (1.35)

s2/cagA+/iceA1/oipA−

2 (2.70)

m1a/cagA+/iceA1/oipA+

5 (6.75)

m1b/cagA+/iceA1/oipA+

2 (2.70)

m1a/cagA+/iceA2/oipA+

1 (1.35)

m1b/cagA+/iceA2/oipA+

m1a/cagA−/iceA1/oipA+

6 (8.10)

m1b/cagA−/iceA1/oipA+

3 (4.05)

m1a/cagA−/iceA2/oipA+

m1b/cagA−/iceA2/oipA+

m1a/cagA+/iceA1/oipA−

5 (6.75)

m1b/cagA+/iceA2/oipA−

2 (2.70)

m2/cagA+/iceA1/oipA+

7 (9.45)

m2/cagA+/iceA2/oipA+

1 (1.35)

m2/cagA+/iceA2/oipA−

1 (1.35)

m2/cagA+/iceA1/oipA−

7 (9.45)

m2/cagA−/iceA1/oipA+

7 (9.45)

m2/cagA−/iceA2/oipA+

1 (1.35)

m2/cagA−/iceA2/oipA−

1 (1.35)

m2/cagA−/iceA1/oipA−

7 (9.45)

aFrom a total of 74 positive strains of H. pylori

Discussion

The results of our study showed that 13.45 % of ready to eat food samples were contaminated with H. pylori which was entirely high. In comparison with other investigations which were conducted on food staffs, the prevalence of H. pylori in our study was higher than those of milk (12.5 %) [22] and vegetable and salad (10.86 %) [7] but was lower than dairy products (19.2 %) [6], vegetable (13.68 %) [8] and restaurant salad (14 %) [8]. To date, various studies have been conducted on the prevalence of H. pylori in foods with animal origin [2225]. In a study accompanied in Italy [23], the H. pylori was detected in more than 25 % of foods with animal origin. Japanese researchers reported the higher levels of contamination in foods with animal origin (72.2 %) [26]. In despite of other foods with animal origin [2226], prevalence of H. pylori in the hamburger, olvie salad and soup (meat based ready to eat food stuffs) of our study were 2, 36 and 22 %, respectively. Prevalence of bacterium in Greek [24] and USA [25] were 20 % and 60 %, respectively which was higher than our results.

One of the most important substances in the preparation of sausage, salami, hamburger, olvie salad, chicken nugget and soup is meat. There were no positive results for chicken nugget, sausage and salami samples of our study. It is maybe related to the application of high temperature during processing of these products. In addition, observation of hygienic conditions in the preparation and packaging of these products maybe another reason for lack of H. pylori. In comparison with sausage, salami and chicken nugget samples, the H. pylori had significant prevalence in hamburger (2 %), olvie salad (36 %) and soup (22 %) samples. High amount of water activity (Aw) in these food samples, optimum pH and salt levels, presence of appropriate levels of amino acids including arginine, histidine, isoleucine, leucine, methionine, phenylalanine, alanine, valine, proline, serine, and tryptophan which are necessary for growth of H. pylori [27], presence of vegetables in some of these foods (olvie salad and soup) which are maybe reservoir for H. pylori [7, 8], unsanitary conditions in their preparation and finally cross contamination of these foods due to handling by factory and food units staffs are the main reasons for the high prevalence of H. pylori in these samples. The results of Mhaskar et al. [28] confirmed the finding of our study about the risk of meat products for H. pylori infection. They reported that the prevalence of peptic ulcer and H. pylori infection were entirely higher in those patients which were used from meat and meat products [odds ratio (OR) 2.35, 95 % confident interval (CI): 1.30–4.23] and restaurant foods (OR 3.77, 95 % CI 1.39–10.23) than vegans.

Preparation of some kinds of these food samples including falafel (pea based fast food with some kinds of vegetables), cream-candy, restaurant salad, traditional bread, fruit salad and olvie salad need moderate levels of water. Roles of contaminated water and even drinking water in transmission of H. pylori have been confirmed previously [2932]. Probably, the water sources used for production and processing of these foods samples were contaminated. Finally, using from unsanitary conditions, handling contamination, use of contaminated equipment and lack of public and individual hygiene are the main reasons for the high prevalence of H. pylori in food samples of our study. Food safety regulations as well as quality standards—including good agricultural practices (GAPs), good manufacturing practices (GMPs) and hazard analysis and critical control points (HACCP)—should be introduced in Iranian food units and factories in order to control contamination and proliferation of pathogenic bacteria.

Another part of our investigation focused on the distribution of vacA, cagA, oipA and iceA genotypes. Results showed that vacA s1a (78.37 %), vacA m2 (75.67 %), vacA m1a (51.35 %) and cagA (41.89 %) were the most commonly detected genotypes in H. pylori strains of ready to eat foods. Our results showed that the cagA gene had the highest prevalence in the hamburger (100 %), soup (81.81 %) and olvie salad (83.33 %). As we said, these are a meat based ready to eat food samples and the high prevalence of cagA gene in these samples maybe showed the high presence of cagA positive strains of H. pylori in the meat used for production of these food stuffs. Yahaghi et al. [8] reported that the oipA (86.44 %), cagA (57.62 %), vacA s1a (37.28 %) and vacA m1a (30.50 %) were the most commonly detected genotypes in the H. pylori isolates of vegetable and salad. They showed that vacA s1c (10.16 %) had low prevalence which was similar to our findings. VacA s1a, m2 and m1a and cagA were the most commonly detected genotypes in the clinical samples of human beings [9, 10, 13, 33], foods [6, 8]) and those of animal sources [9]. Close association of vacA and cagA genotypes with interleukin 8 (IL-8) production, cytotoxin production, gastric epithelial cells adhesion, inflammatory effects, vacuolization and apoptosis in gastric epithelial cells has been observed previously [34, 35]. Since H. pylori isolates in our study harbored vacA and cagA genotypes, consumption of ready to eat foods contaminated with virulent strains may provoke duodenal ulceration, gastric mucosal atrophy and gastric cancer.

Another important finding of our investigation is about the presence of high antibiotic resistance in the H. pylori strains of ready to eat food samples. Our results revealed that the H. pylori strains of ready to eat food samples had the high levels of antibiotic resistance against ampicillin, metronidazole, erythromycin, amoxicillin, tetracycline and trimethoprim. Similar findings have been reported previously by Yahaghi et al. [8], Thyagarajan et al. [36], Secka et al. [37] and Bang et al. [38]. Low levels of antibiotic resistance in the H. pylori strains against spiramycin, furazolidone, cefsulodin, rifampin, streptomycin and levofloxacin is may be due to the regular and low prescription of these antibiotics. Epidemiological investigations of Nigeria, Senegal, Iran, India, China, Taiwan, Saudi-Arabia, Thailand, Egypt, Brazil, Colombia and Argentina showed that the H. pylori isolates of human clinical specimens had the highest levels of resistance against metronidazole, amoxicillin, quinolones and tetracycline [39] which was similar to our results.

The results of antimicrobial resistance pattern had indirectly confirmed that the H. pylori strains of hamburger, soup and olvie salad (meat based ready to eat foods) were transferred from the meat samples of infected animals. It is because of the H. pylori strains of these food stuffs were relatively resistant to the antibiotics used especially in the veterinary medicine. Prescription of metronidazole, clarithromycin, levofloxacin, rifampin, cefsulodin, furazolidone and spiramycin antimicrobial agents is not routine in the cases of diseases in animals. Therefore, the prevalence of resistance against these antibiotics in the H. pylori strains of hamburger, soup and olvie salad samples which are relatively made from meat is low and this finding can indirectly confirm the primary infections of meat used from production of hamburger, soup and olvie salad.

Conclusions

In conclusion, ready to eat foods in Iran harbor H. pylori strains with high prevalence of vacA, cagA, iceA and oipA genotypes. High prevalence of H. pylori in our samples suggest that contaminated ready to eat foods maybe the sources of the bacteria and that it entered the human population in period of time. Diversity of H. pylori genotypes between various types of ready to eat food samples maybe showed that there were various sources of contamination for these food stuffs. Bacterial strains had the lowest levels of resistance against spiramycin and furazolidone which was quite interesting. The most important finding of this study is that the ready to eat food stuffs harbored virulent and resistant strains of H. pylori. Carefully prescription of antibiotics with respect to the results of disk diffusion method and cautious health monitoring on food and staffs of food producing companies maybe reduce the risk of virulent and resistant strains of H. pylori in Iranian food samples.

Abbreviations

H. pylori

Helicobacter pylori

VacA

vacuolating cytotoxin

IceA

induced by contact with the epithelium antigen

Cag

cytotoxin associated gene

Oip

outer inflammatory protein

PCR: 

polymerase chain reaction

Declarations

Authors' contributions

BH and ER contributed to study design. BH collected the samples, DNA extraction and culture examinations. ER contributed to PCR analysis and data interpretation. BH and ER wrote and drafted the manuscript. HM contributed on the statistical analysis.

Acknowledgements

The authors would like to thank Dr. Farhad Safarpoor Dehkordi at the Department of Food Hygiene and Quality Control, University of Tehran, his important technical support. This work was supported by the Azad University, Shahrekord, Iran, grant n. 94/90215.

Competing interests

The authors declare that they have no competing interests

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Graduated Student of Veterinary Medicine, College of Veterinary Medicine, Islamic Azad University
(2)
Department of Microbiology, College of Basic Sciences, Islamic Azad University
(3)
Department of Food Hygiene and Public Health, College of Veterinary Medicine, Islamic Azad University

References

  1. Shrestha S, Paudel P, Pradhan GB, Shrestha L, Bhattachan CL. Prevalence study of H. pylori infection in dyspeptic patients coming to Nepal Medical College Teaching Hospital, Jorpati, Kathmandu. Nepal Med Coll J. 2012;14:229–33.PubMedGoogle Scholar
  2. Mastromarino P, Conti C, Donato K, Strappini PM, Cattaruzza MS, Orsi GB. Does hospital work constitute a risk factor for Helicobacter pylori infection. J Hosp Infect. 2005;60:261–8.PubMedView ArticleGoogle Scholar
  3. Vu C, Ng YY. Prevalence of Helicobacter pylori in peptic ulcer disease in a Singapore hospital. Singapore Med J. 2000;41:478–81.PubMedGoogle Scholar
  4. Webberley MJ, Webberley JM, Newell DG, Lowe P, Melikian V. Seroepidemiology of Helicobacter pylori infection in vegans and meat-eaters. Epidemiol Infect. 1992;108:457–62.PubMedPubMed CentralView ArticleGoogle Scholar
  5. Stevenson TH, Bauer N, Lucia LM, Acuff GR. Attempts to isolate Helicobacter from cattle and survival of Helicobacter pylori in beef products. J Food Protect. 2000;63:174–8.Google Scholar
  6. Mousavi S, Safarpoor Dehkordi F, Rahimi E. Virulence factors and antibiotic resistance of Helicobacter pylori isolated from raw milk and unpasteurized dairy products in Iran. J Venom Anim Toxins Incl Trop Dis. 2014;20:51.Google Scholar
  7. Atapoor S, Safarpoor Dehkordi F, Rahimi E. Detection of Helicobacter pylori in various types of vegetables and salads. Jundishapur J Microbiol. 2014;7:e10013.PubMedPubMed CentralView ArticleGoogle Scholar
  8. Yahaghi E, Khamesipour F, Mashayekhi F, Safarpoor Dehkordi F, Sakhaei MH, Masoudimanesh M, Khameneie MK. Helicobacter pylori in vegetables and salads: genotyping and antimicrobial resistance properties. Biomed Res Int. 2014;2014:757941.Google Scholar
  9. Momtaz H, Dabiri H, Souod N, Gholami M. Study of Helicobacter pylori genotype status in cows, sheep, goats and human beings. BMC Gastroenterol. 2014;14:61.PubMedPubMed CentralView ArticleGoogle Scholar
  10. Momtaz H, Souod N, Dabiri H, Sarshar M. Study of Helicobacter pylori genotype status in saliva, dental plaques, stool and gastric biopsy samples. World J Gastroenterol. 2012;18:2105–11.PubMedPubMed CentralView ArticleGoogle Scholar
  11. Torres LE, Melián K, Moreno A, Alonso J, Sabatier CA, Hernández M, Bermúdez L, Rodríguez BL. Prevalence of vacA, cagA and babA2 genes in Cuban Helicobacter pylori isolates. World J Gastroenterol. 2009;15:204–10.PubMedPubMed CentralView ArticleGoogle Scholar
  12. Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, Yamazaki Y, Keida Y, Higashi H, Hatakeyama M, Azuma T. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol. 2005;43:3906–16.PubMedPubMed CentralView ArticleGoogle Scholar
  13. Momtaz H, Souod N, Dabiri H. Comparison of the virulence factors of Helicobacter pylori isolated in stomach and saliva in Iran. Am J Med Sci. 2010;340:345–9.PubMedView ArticleGoogle Scholar
  14. Ho SA, Hoyle JA, Lewis FA. Direct polymerase chain reaction test for detection of Helicobacter pylori in humans and animals. J Clin Microbiol. 1991;29:2543–9.PubMedPubMed CentralGoogle Scholar
  15. Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing. Twenty-second informational supplement M100-S21, Wayne Pa, 2012.Google Scholar
  16. Wang J, Chi DS, Laffan JJ, Ferguson DA Jr, Litchfield P, Thomas E. Comparison of cytotoxin genotypes of Helicobacter pylori in stomach and saliva. Dig Dis Sci. 2002;47:1850–6.PubMedView ArticleGoogle Scholar
  17. Kauser F, Hussain MA, Ahmed I, Ahmad N, Habeeb A, Khan AA, Ahmed N. Comparing genomes of Helicobacter pylori strains from the high-altitude desert of Ladakh, India. J Clin Microbiol. 2005;43:1538–45.PubMedPubMed CentralView ArticleGoogle Scholar
  18. Thirumurthi S, Graham DY. Helicobacter pylori infection in India from a western perspective. Ind J Med Res. 2012;136:549–62.Google Scholar
  19. Tumurru MK, Cover TL, Blaser MJ. Cloning and expression of a highmolecular mass major antigen of Helicobacter pylori: evidence of linkage to cytotoxin production. Infect Immun. 1993;61:1799–809.Google Scholar
  20. Peek RM, Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ, Miller GG. Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome. Proc Assoc Am Physicians. 1998;110:531–44.PubMedGoogle Scholar
  21. Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in Eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 1991;19:6823–31.PubMedPubMed CentralView ArticleGoogle Scholar
  22. Rahimi E, Kheirabadi EK. Detection of Helicobacter pylori in bovine, buffalo, camel, ovine, and caprine milk in Iran. Foodborne Pathog Dis. 2012;9:453–6.PubMedView ArticleGoogle Scholar
  23. Quaglia NC, Dambrosio A, Normanno G, Parisi A, Patrono R, Ranieri G, Rella A, Celano GV. High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection. Int J Food Microbiol. 2008;124:43–7.PubMedView ArticleGoogle Scholar
  24. Angelidis AS, Tirodimos I, Bobos M, Kalamaki MS, Papageorgiou DK, Arvanitidou M. Detection of Helicobacter pylori in raw bovine milk by fluorescence in situ hybridization (FISH). Int J Food Microbiol. 2011;151:252–6.PubMedView ArticleGoogle Scholar
  25. Dore MP, Sepulveda AR, El-Zimaity H, Yamaoka Y, Osato MS, Mototsugu K, Nieddu AM, Realdi G, Graham DY. Isolation of Helicobacter pylori from sheep-implications for transmission to humans. Am J Gastroenterol. 2001;96:1396–401.PubMedGoogle Scholar
  26. Fujimura S, Kawamura T, Kato S, Tateno H, Watanabe A. Detection of Helicobacter pylori in cow’s milk. Lett Appl Microbiol. 2002;35:504–7.PubMedView ArticleGoogle Scholar
  27. van Duynhoven YT, de Jonge R. Transmission of Helicobacter pylori: a role for food. Bull World Health Organ. 2001;79:455–60.PubMedPubMed CentralGoogle Scholar
  28. Mhaskar RS, Ricardo I, Azliyati A, Laxminarayan R, Amol B, Santosh W, Boo K. Assessment of risk factors of Helicobacter pylori infection and peptic ulcer disease. J Glob Infect Dis. 2013;5:60–7.PubMedPubMed CentralView ArticleGoogle Scholar
  29. Queralt N, Bartolomé R, Araujo R. Detection of Helicobacter pylori DNA in human faeces and water with different levels of faecal pollution in the north–east of Spain. J Appl Microbiol. 2005;98:889–95.PubMedView ArticleGoogle Scholar
  30. Dube C, Tanih NF, Ndip RN. Helicobacter pylori in water sources: a global environmental health concern. Rev Environ Health. 2009;24:1–14.PubMedView ArticleGoogle Scholar
  31. Samra ZQ, Javaid U, Ghafoor S, Batool A, Dar N, Athar MA. PCR assay targeting virulence genes of Helicobacter pylori isolated from drinking water and clinical samples in Lahore metropolitan, Pakistan. J Water Health. 2011;9:208–16.PubMedView ArticleGoogle Scholar
  32. Amirhooshang A, Ramin A, Ehsan A, Mansour R, Shahram B. High frequency of Helicobacter pylori DNA in drinking water in Kermanshah, Iran, during June–November 2012. J Water Health. 2014;12:504–12.PubMedView ArticleGoogle Scholar
  33. Havaei A, Mohajeri P, Khashei R, Salehi R, Tavakoli H. Prevalence of Helicobacter pylori vacA different genotypes in Isfahan, Iran. Adv Biomed Res. 2014;3:48.PubMedPubMed CentralView ArticleGoogle Scholar
  34. Yamaoka Y, Reddy R, Graham DY. Helicobacter pylori virulence factor genotypes in children in the United States: clues about genotype and outcome relationships. J Clin Microbiol. 2010;48:2550–1.PubMedPubMed CentralView ArticleGoogle Scholar
  35. Siddique I, Al-Qabandi A, Al-Ali J, Alazmi W, Memon A, Mustafa AS, Junaid TA. Association between Helicobacter pylori genotypes and severity of chronic gastritis, peptic ulcer disease and gastric mucosal interleukin-8 levels: evidence from a study in the Middle East. Gut Pathog. 2014;6:41.PubMedPubMed CentralView ArticleGoogle Scholar
  36. Thyagarajan SP, Ray P, Das BK, Ayyagari A, Khan AA, Dharmalingam S, Rao UA, Rajasambandam P, Ramathilagam B, Bhasin D, Sharma MP, Naik SR, Habibullah CM. Geographical difference in antimicrobial resistance pattern of Helicobacter pylori clinical isolates from Indian patients: multicentric study. J Gastroenterol Hepatol. 2003;18:1373–8.PubMedView ArticleGoogle Scholar
  37. Secka O, Berg DE, Antonio M, Corrah T, Tapgun M, Walton R, Thomas V, Galano JJ, Sancho J, Adegbola RA, Thomas JE. Antimicrobial susceptibility and resistance patterns among Helicobacter pylori strains from The Gambia, West Africa. Antimicrob Agents Chemother. 2013;57:1231–7.PubMedPubMed CentralView ArticleGoogle Scholar
  38. Bang SY, Han DS, Eun CS, Kim JE, Ahn SB, Sohn JH, Jeon YC, Kang JO. Changing patterns of antibiotic resistance of Helicobacter pylori in patients with peptic ulcer disease. Korean J Gastroenterol. 2007;50:356–62.PubMedGoogle Scholar
  39. World Gastroenterology Organization (WGO). Global guideline. Helicobacter pylori in developing countries, 2010.Google Scholar

Copyright

© Hemmatinezhad et al. 2016

Advertisement