Skip to content

Advertisement

  • Research
  • Open Access

Adherent/invasive Escherichia coli (AIEC) isolates from asymptomatic people: new E. coli ST131 O25:H4/H30-Rx virotypes

  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 2 and
  • 1Email author
Annals of Clinical Microbiology and Antimicrobials201817:42

https://doi.org/10.1186/s12941-018-0295-4

  • Received: 25 April 2018
  • Accepted: 1 December 2018
  • Published:

Abstract

Background

The widespread Escherichia coli clone ST131 implicated in multidrug-resistant infections has been recently reported, the majority belonging to O25:H4 serotype and classified into five main virotypes in accordance with the virulence genes carried.

Methods

Pathogenicity Islands I and II (PAI-I and PAI-II) were determined using conventional PCR protocols from a set of four E. coli CTXR ST131 O25:H4/H30-Rx strains collected from healthy donors’ stool. The virulence genes patterns were also analyzed and compared them with the virotypes reported previously; then adherence, invasion, macrophage survival and biofilm formation assays were evaluated and AIEC pathotype genetic determinants were investigated.

Findings

Non-reported virulence patterns were found in our isolates, two of them carried satA, papA, papGII genes and the two-remaining isolates carried cnfI, iroN, satA, papA, papGII genes, and none of them belonged to classical ST131 virotypes, suggesting an endemic distribution of virulence genes and two new virotypes. The presence of PAI-I and PAI-II of Uropathogenic E. coli was determined in three of the four strains, furthermore adherence and invasion assays demonstrated higher degrees of attachment/invasion compared with the control strains. We also amplified intI1, insA and insB genes in all four samples.

Interpretation

The results indicate that these strains own non-reported virotypes suggesting endemic distribution of virulence genes, our four strains also belong to an AIEC pathotype, being this the first report of AIEC in México and the association of AIEC with healthy donors.

Keywords

  • AIEC
  • IBD
  • Crohn’s disease
  • Virotype

Background

Escherichia coli is one of the predominant Gram negative bacterial species of the intestinal microbiota. It mainly colonizes the gastrointestinal tract but also extra intestinal environments. Among E. coli strains there are some considered pathogens and others pathobionts, this depending on the virulence factors that they expressed. E. coli genetic variability is caused mostly by horizontal gene transfer, acquiring virulence factors and antibiotic resistance genes. This acquisition is mediated by mobile genetic elements (MGEs), such as transposons, plasmids, bacteriophages and Pathogenicity Islands (PAI) [1]. These elements enhance bacterial capacity to survive in the host environment and to adapt to it. A well accepted infectious disease paradigm indicates that the development of antibiotic resistance allows susceptible species to overtake resistant species [1]. Nevertheless, the increasing evidence of the rising threat of antibiotic resistant bacteria suggests that the evolution of resistance may be more associated with a fitness advantage, including enhanced virulence [2, 3].

Extended-spectrum β-lactamases (ESBL) are enzymes that hydrolyze penicillins by disruption of β-lactam ring and also third generation cephalosporins [4]. The largest group of ESBL are the cefotaximases (CTX-Ms), which have become globally disseminated, being blaCTX-M-15 and blaCTX-M-14 the predominant genotypes. This group of ESBL restricts treatment options, increasing the use of carbapenems, and leading to the emergence and spread of carbapenemase-producing Enterobacteriaceae [5, 6]. There is an increasing prevalence of β-lactamase resistance due to ESBL, particularly the presence of CTX-M enzymes, and associated fluoroquinolone resistance in MGEs in Extra-Intestinal Pathogenic Escherichia coli (ExPEC), being a serious global clinical problem during the last decade [7].

The Type I fimbrial adhesin FimH has been associated with E. coli pathogenicity because some fimH variants enhance uroepithelial colonization [8]. Furthermore, the fimH-30 variant has been linked with high fluoroquinolone resistance levels simultaneously with ESBL CTX-M-15 production (H30-Rx) [9, 10]. Additionally, E. coli isolates can be classified using the multilocus sequence typing (MLST) technique, sequencing seven housekeeping genes (adk, fumC, gyrB, icd, mdh, purA, recA). Using the MLST scheme, ST131 clones have been classified, which have been identified worldwide spread [11, 12]. Increasing prevalence of antibiotic resistance and ESBL CTX-M-15 production in UPEC strains has been linked to this sequence type [1318].

Clermont et al. [19], established a method based on multiplex PCR for chuA, yjaA, TspE4.C2, arpA and trpA genes, classifying E. coli strains into seven phylogroups and one clade. E. coli ST131 strains belong to phylogenetic group B2 in subgroup I, [19, 20] and they belong mostly to the O25:H4 serotype, although some strains have been found to be O16:H5 serotype [2127]. It is well known that B2 strains harbor several virulence factors and there is a scheme that classifies the E. coli ST131 into five virotypes (A to E). These virotypes depend on the presence or absence of pap (adhesin-encoding P fimbriae), cnfI (cytotoxic necrotizing factor), sat (secreted autotransporter toxin), kpsMII (group 2 capsule synthesis), iroN (catecholate siderophore receptor), afa/draBC (Afa/Dr adhesins), ibeA (invasion of brain endothelium), hlyA (alpha-hemolysin) and cdtB (cytolethal distending toxin) genes (Table 3). This scheme has been useful to infer virulence in strains isolated worldwide and to determine intercontinental spread [11, 14, 16, 28, 29]. ST131 strains have been linked with community- and hospital-acquired urinary tract infections (cystitis and pyelonephritis) worldwide, but also have been reported to cause other infections as bacteremia, intra-abdominal and soft tissue infections, meningitis, epididymo-orchitis, osteoarticular infections, myositis and septic shock [3038].

There are six well characterized Intestinal or Diarrheagenic E. coli pathotypes: Enterohemorrhagic E. coli (EHEC), enteroaggregative E. coli (EAEC), enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC) and diffusely adherent E. coli (DAEC), all of them displaying a broad range of virulence factors affecting critical host cell processes [39, 40]. The E. coli strains that cause extra intestinal infections are currently known as ExPEC, and they are the etiological agent of 80% of urinary tract infections (UTIs) [39]. They are also a frequent cause of peritonitis and neonatal meningitis [41]. In addition to these E. coli pathogenic groups, a new pathotype of adherent/invasive E. coli (AIEC) was recently described and characterized, and it has been involved in inflammatory bowel diseases such as Crohn’s disease and ulcerative colitis [42, 43].

AIEC adheres and invades epithelial cells and replicates into macrophages [42, 44]. Its adhesion is mediated by binding of the type 1 pili to the host glycoprotein carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) on the intestinal epithelial cells [45, 46]. The type 1 pilus is present in almost all E. coli strains and is known to bind mannose sugar receptor sequences found on host cell surfaces [47]. There are two well characterized prototype AIEC strains, LF82 and NRG857c [42, 43]. Both strains are phylogenetically related to ExPEC, they belong to serotype O83:H1, to the B2 phylogenetic group and they have been related with the presence of insA, insB (which encodes a transposase in IS1) and vat (which encodes for a vacuolating autotransporter toxin) genes [48, 49].

The aims of this study were to determinate the virulence patterns and the pathotype on a collection of MDR E. coli ST131 O25:H4/H30-Rx strains recovered from asymptomatic donors.

Methods

Bacterial strains and culture conditions

A collection of four E. coli CTXR ST131 O25:H4/H30-Rx strains, isolated from healthy donors’ stool samples and belonging to the phylogenetic group B2 (C7223, C7225, C7226 and C7230) which had specific resistance patterns and its fimH variant determined, were used in this study (Table 1) [50]. Additionally, E. coli C600, O157-H7 (EHEC), B171-8 (EPEC), EAEC, ETEC and CFT073 (UPEC) strains were used as controls. All strains were grown at 37 °C in LB (Luria–Bertani) media. For adherence and invasion assays, after the overnight culture, E. coli B171-8 strain was incubated in DMEM (Dulbecco’s Modified Eagle’s Medium) at 37 °C.
Table 1

Characteristics E. coli CTXR ST131 O25:H4/H30-Rx strains.

Data obtained from Cortés-Cortés et al. [50]

Strain

β-lactamic Resistance profile

Non-β-lactamic Resistance profile

Genetic resistance determinant

Phylogenetic group

ST/ST complex

AIEC genesa

Virulence genesa

C7223

AMP, AMC, CTX, CAZ

NA, CIP, S, T, TE, SXT

blaCTX-M15, blaOXA-1, aac(6′)-Ib-cr, tet(A)

B2

4225/131

insA, insB, intI1

fimH, iha, iucD, satA, papA, papGII

C7225

AMP, AMC, CTX, CAZ, FEP

NA, CIP, GM, AK, T, TE,

blaCTX-M15, blaOXA-1, aac(6′)-Ib-cr, tet(A), aac(3′)-II

B2

131/131

insA, insB, intI1

fimH, iha, iucD, satA, papA, papGII

C7226

AMP, AMC, CTX, CAZ, FEP

NA, CIP, GM, AK, T, TE

blaCTX-M15, blaOXA-1, aac(6′)-Ib-cr, aac(3′)-II

B2

131/131

insA, insB, intI1

fimH, iha, iucD, cnfI, iroN, papA, papGII

C7230

AMP, CTX, CAZ, FEP, IMP

NA, CIP, S, GM, T, TE

blaCTX-M15, tet(A),

B2

131/131

insA, insB, intI1

fimH, iha, iucD, cnfI, iroN, papA, papGII

CTXR Resistant to cefotaxime, O25:H4/H30-Rx serotype/fimH variant-resistance to fluoroquinolones simultaneously with ESBL CTX-M-15 production, AMP ampicillin, AMC amoxicillin/clavulanic acid, CTX cefotaxime, CAZ ceftazidime, FEP cefepime, IMP imipenem, NA nalidixic acid, CIP ciprofloxacin, AK amikacin, GM gentamicin, T tobramicin, TE tetracycline, SXT sulfamethoxazole trimetoprim, S streptomycin

aThis study

Strains characterization by the presence of virulence and AIEC related genes

Specific primers were used for amplification of PAI-ICFT073 (RPAi and RPAf) and PAI-IICFT073 (Cft073.2Ent1 and cft073.2Ent2), PAI-IJ96 (papGIf and papGIr) and PAI-IIJ96 (hlyD and cnf), iucD, satA, papA, papGII, papGIII, cnfI, iroN, afa, afa/draBC, ibeA, hlyA, cdtB, neuC-KI, intI1, insA, insB, vat, bfpA, stxI, stxII, thermo-labile toxin, thermo-stable toxin, EAEC plasmid, eae, eaf and daaE genes for multiplex and simplex conventional PCR protocols (Table 2).
Table 2

Specific primers used in this study

Target

Primer name

Sequence 5′ to 3′

Tm ( °C)

Amplicon size

Reference

PAI-ICFT073

RPAi

GGACATCCTGTTACAGCGCGCA

65

925 bp

[68]

RPAf

TCGCCACCAATCACAGCGAAC

PAI-IICFT073

Cft073.2Ent1

ATGGATGTTGTATCGCGC

55

400 bp

[69]

cft073.2Ent2

ACGAGCATGTGGATCTGC

PAI-IJ96

PapGIf

TCGTGCTCAGGTCCGGAATTT

57.7

400 bp

[68]

PapGIr

TGGCATCCCACATTATCG

PAI-IIJ96

Hlyd

GGATCCATGAAAACATGGTTAATGGG

59.3

2.3 kb

[70]

Cnf

GATATTTTTGTTGCCATTGGTTACC

fimH

FimH-F

CACTCAGGGAACCATTCAGGCA

57

975 bp

[71]

FimH-R

CTTATTGATAAACAAAAGTCAC

Iron

IRON-F

AAGTCAAAGCAGGGGTTGCCCG

60

667 bp

[16]

IRON-R

GACGCCGACATTAAGACGCAG

afa operon

AFA025-F

GAGTCACGGCAGTCGCGGCGG

55

207 bp

[72]

AFA025-R

TTCACCGGCGACCAGCCATCTCC

afa/draBC

Afa-DraF

GGCAGAGGGCCGGCAACAGGC

60

559 bp

[68]

Afa-DraR

CCCGTAACGCGCCAGCATCTC

ibeA

IBEA 10 F

AGGCAGGTGTGCGCCGCGTAC

60

170 bp

[68]

IBEA 10 R

TGGTGCTCCGGCAAACCATGC

cnfI

cnf-f

ATCTTATACTGGATGGGATCATCTTGG

60

974 bp

[73]

cnf-r

GCAGAACGACGTTCTTCATAAGTAT

cdtB

cdtB-f

AACTGATTTTCGCGTTGCGA

60

741 bp

This study

cdtB-r

GATACGCCAACAGGGAAATG

neuC-KI

kpsII-f

GATACGCCAACAGGGAAATG

63

272 bp

[68]

kpsII-r

CATCCAGACGATAAGCATGAGCA

KI-f

TAGCAAACGTTCTATTGGTGC

153 bp

insA

insA-f

GGCATCCAACGCCATTCAT

62

178 bp

This study

insA-r

TGTCCCTCCTGTTCAGCTACTGA

insB

insB-f

ATGTTCAGATAATGCCCGATG

62

461 bp

This study

insB-r

CGTTGGCCTCAACACGATTT

vatA

vatA1076F

CCTGGGACATAATGGTCAGAT

61

330 bp

Arenas-Hernández unpublished data

vatA1406R

CTGGCAATATTCACGCTACTG

vatP

vatP-86F

TAGCGCGCAATTCAACAATA

61

226 bp

Arenas-Hernández unpublished data

vatP226R

GCAGATAGTGCCAGAGAGGTAAG

intI1

IntI1-F

GGGTCAAGGATCTGGATTTCG

62

483 bp

[74]

IntI1-R

CGACGATGATTTACACGCATGT

papa

papA-45F

CAGATATCTCGGTGTGTTCAGTAA

61

641 bp

Arenas-Hernández unpublished data

papA + 31R

GGTCTTGCCTCACCCTGTAA

iha

ihaEMSAR

CGGAATTCCGATCTCCGATCATGTTAACCG

61

150 bp

[75]

ihaEMSAL

CGGAATTCCGGCATGCCGAGGCAGTCGTTA

iucD

iucD-30F

GCTGTGGCTGGTAACTCAGG

58

512 bp

Arenas-Hernández unpublished data

iucD512R

TGCTTCACACAGGGTGGTAAAT

fliC

FliC 242F

GCTGTCCGAAATCAACAACAA

58

304 bp

Arenas-Hernández unpublished data

FliC 445 R

GGCTATCGTACCGGAACCATT

Fimbrial adhesin subunit

daaE-F

TGACTGTGACCGAAGAGTGC

48

380 bp

[76]

daaE-R

TTAGTTCGTCCAGTAACCCCC

IS3 Transposase family

STI-F

TTAATAGCACCCGGTACAAGCAGG

64

147 bp

[77]

STI-R

CTTGACTTCTTCAAAAGAGAAAATTAC

Heat-stable enterotoxin

STaII-F

TTGTCTTTTTCACCTTTCCC

60

93 bp

[78]

STaII-R

ACAAGCAGGATTACAACACA

Heat-labile enterotoxin

LT-F

GGCGACAGATTATACCGTGC

60

750 bp

[79]

LT-R

CCGAATTCTGTTATAATATGTC

Intimin

eae-F

CAGGTCGTCGTGTCTGCTAAA

67

1087 bp

[80]

eae-R

TCAGCGTGGTTGGATCAACCT

Shiga toxin 1

STx1-F

TTTACGATAGACTTCTCGAC

55

227 bp

[81]

STx2-R

CACATATAAATTATTTCGCTC

Shiga toxin 2

STx2-F

CCCAGTCACGACGTTGTA

60

460 bp

[78]

STx2-R

TATACTATCGTGCCTTTCCA

ial

ial-F

CTGGATGGTATGGTGAGG

60

320 bp

[82]

ial-R

GGAGGCCAACAATTATTTCC

EAF

EAF-F

CAGGGTAAAAGAAAGATGATAA

58

1087 bp

[83]

EAF-R

TATGGGGACCATGTATTATCA

bfpA

bfpA-F

AATGGTGCTTGCGCTTGCTGC

67

326 bp

[79]

bfpA-R

GCCGCTTTATCCAACCTGGTA

EAEC plasmid

EAEC-F

CTGGCGAAAGACTGTATCAT

60

630 bp

[84]

EAEC-R

CAATGTATAGAAATCGCTGTT

Adherence assay

HeLa cells were seeded on tissue culture plates in Minimum Essential Media (MEM) (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific) at 37 °C in 5% CO2 until sub-confluence. Then, 5 mL of FC Wash solution with 0.25% trypsin solution was added, incubated 3 min at 37 °C and decanted. Fresh MEM + 10%FBS was added. Cells were adjusted to 5 × 104/mL, 425 µL were seeded on each well of an eight-well Millicel® EZ slides (Merck Millipore). The slide was then incubated overnight at 37 °C in 5% CO2. HeLa cells monolayers were washed with sterile PBS. After washing, 250 µL of bacterial suspension in MEM supplemented with 1% mannose were added in each well (1:20) and incubated for 2 h at 37 °C in 5% CO2. After incubation, wells were washed twice with PBS. Methanol was used to fix cells monolayers for 10 min and samples were stained with Giemsa. The adhered bacteria number was directly counted microscopically in at least 14 fields of each well; result is expressed as the average bacteria number per cell [42].

Invasion assay

For invasion assays HeLa cells were grown until 70% to 80% confluence and used to seed 8 well glass slides (Millicel ® EZ slides) with a concentration of 5 × 104 mL and incubated overnight at 37 °C in 5% CO2. Monolayers were washed with sterile PBS. After washing, the slides were inoculated with a suspension (1:20) of bacteria in MEM supplemented with 1% mannose. Slides were incubated 3 h at 37 °C in 5% CO2 and washed with PBS. Then, slides were incubated with MEM supplemented with 100 µg/mL rifampicin for 1 h and washed again with sterile PBS. To disrupt cells, 250 µL of 0.1% TritonX-100 was added and dilutions 1:1 to 1:5 were plated on LB agar to count CFUs [42].

Biofilm formation assay

The ability to form biofilms was determined in a 96 wells plate. Bacteria were incubated in BHI (Brain–Heart Infusion) broth for 24 h and 48 h at 37 °C and biofilm formation was determined according with protocols previously reported [51, 52].

Macrophage replication assay

J774 macrophages were grown in MEM supplemented with 10% FBS and incubated under a 5% CO2 atmosphere at 37 °C. Bacteria cultures were prepared inoculating 3 mL of LB broth with several E. coli colonies from LB agar plates. Macrophages were seeded into eight-well Millicel ® EZ slide at 5 × 104/mL and incubated overnight. The next day, macrophages were infected with E. coli strains at MOI (multiplicity of infection) of 100 and incubated for 3 h at 37 °C, 5% CO2. The medium was removed, and the cells were washed twice with sterile PBS and incubated with 100 µg/mL rifampicin in high glucose DMEM + 10% FBS for 1 h. The cells were washed twice with sterile PBS and lysed with 0.1% Triton X-100 for 10 min to release intracellular bacteria. Samples were serially diluted from 101 to 104 in PBS, plated on LB agar, and incubated at 37 °C overnight. Survival represents the product of invasion plus intracellular replication minus phagocytosis. Counts above 100 CFU indicate replication. All assays were done in triplicate in three independent trials [55].

Gene sequencing

After PCR, genes of interest were purified with Zymo-Clean® Gel DNA Recovery Kit (Zymo Research) and sequenced by Sanger methodology at Unidad de Sequenciación IBT-UNAM. Sequences were visualized and analyzed with FinchTV® software and annealing packages from Clustall Omega.

Statistical analysis

To determine significant differences between measures, two-way ANOVA analysis were performed with Bonferroni test, and with a 95% confidence interval with a P value < 0.01 using GraphPad® from Prisma software package.

Results

E. coli ST131 O25:H4/H30-Rx virulence genes

The presence of 17 virulence genes was studied in our four bacteria strains, including fimH, papA, iha, iucD, iutA, fliC, afa/draBC, afa operon, iroN, sat, ibeA, papGII cnfI, hlyA, papGIII, cdtB and neuC-KI. A differential genetic presence was observed in two well defined virulence gene arrangements which do not correspond with the previously reported virotypes for E. coli ST131 [11]. The two new proposed patterns were virotype F found in C7226 and C7230 strains; and virotype G found in C7223 and C7225 strains (Tables 1 and 3).
Table 3

E. coli ST131 O25:H4/H30-Rx virotypes, according with the virulence genes content.

Modified from Nicolas-Chanoine et al. [11]

Virotype

Virulence factors encoding genes

afa/draBC

afa operon

iroN

sat

ibeA

papGII

cnfI

hlyA

papGIII

cdtB

neuC-K1

A

+

+

±

B

+

±

C

+

D

±

±

±

±

+

±

±

±

±

±

E

+

+

+

+

Fa

+

+

+

Ga

+

+

anew proposed virotype; +, positive PCR result; −, negative PCR result. afa/draBC, Afa/Dr adhesins; afa operon, FM955459; iroN, catecholate siderophore receptor; sat, secreted autotransporter toxin; ibeA, invasion of brain endothelium; papGII, allele II of papG gene; cnf1, cytotoxic necrotizing factor type 1; hlyA, alpha-hemolysin; papGIII, allele III of papG gene; cdtB, cytolethal distending toxin; neuC-K1, K1 variant of group II capsule

The multiplex PCRs performed for papA, papGII, papGIII, iha, satA, iucD, iutA, fliC, fimH and for PAI-I and PAI-II of UPEC CFT073 and J96, were used to identify extra intestinal pathotypes. We amplified papA, papGII, iha, satA, iucD and fimH in all four E. coli ST131 strains; PAI-I and PAI-II of CFT073 for C7225, C7226 and C7230 (Table 1). Furthermore, PCRs for each diarrheagenic pathotype were performed and none of the four strains tested could be classified into these six pathotypes. These findings confirmed that all strains belong to extra intestinal pathotype.

Relationship between the E. coli ST131 O25:H4/H30-Rx virotypes, the ESBL variants and its resistance genotype

As E. coli resistance traits has been linked with MGEs which also carry virulence determinants, we determined the association between resistance and virulence genes present among these four strains. Previously, Cortés-Cortés et al. [50] (Table 1) reported differential resistance patterns to β-lactamic and non β-lactamic antibiotics, phylogroup and fimH variant. Additionally, we performed PCR and sequencing of the gyrA and parC genes from all four healthy donors’ strains, and obtained the classical mutation (S80I and E84V for parC and S93L and E97N or S93I and E97V for gyrA) previously reported [53]. Because of the different resistance patterns in our four strains, we did not observe a relationship between resistance and virulence that suggested a co-occurrence of these traits in a MGE.

Phenotyping of E. coli ST131 O25:H4/H30-Rx strains as AIEC pathotype

To evaluate these strains as potential members of AIEC pathotype, HeLa cells were infected with each strain and adhesion, invasion assays were performed (Fig. 1). C7223 strain showed the highest adherence levels (60.4 bacteria/cell) as compared to other adherent E. coli strains and thirty times higher than UPEC and K-12 strain. The other three strains showed less bacterial adherence per cell but more than the UPEC strain (Fig. 1). However, in invasion assays C7223 showed less invasiveness than the other three strains. Furthermore C7225 and C7226 showed 6 logs of difference with respect to the C7223 strain (Fig. 2b). Moreover, we tested the survival rate in macrophages. The survival rate in macrophages was also the highest in C7225 and C7226 strains (2.3 × 105 and 2.0 × 105 CFUs, respectively), followed by C7230 strain (4.4 × 103 CFUs) and C7223 strain (3.3 × 102 CFUs) (Fig. 3a and Table 4). These data confirm that these four strains of E. coli ST131 O25:H4/H30-Rx own similar phenotypic characteristics to the AIEC strains previously reported [42, 43].
Fig. 1
Fig. 1

Adherence patterns observed in E. coli ST131 O25:H4/H30-Rx strains. A E. coli K-12, B UPEC CFT073, C C7223, D C7225, E C7226, F C7230. All strains were triple tested and stained with Giemsa

Fig. 2
Fig. 2

Adherence (a) and invasion (b) assays for the E. coli ST131 O25:H4/H30-Rx strains. All strains were triple tested. An * shows significant differences

Fig. 3
Fig. 3

Survival within macrophages and Biofilm formation. E. coli ST131 O25:H4/H30-Rx within J774 macrophages (a), all strains were triple tested, and biofilm formation assay (b), all strains were tested eight times. An * shows significant differences

Table 4

Characterization of E. coli ST131 O25:H4/H30-Rx strains with traits of the AIEC pathotype

Strain

Adherence ratea

Invasion rateb

Survival within macrophagesc

Biofilm formation rated

C7223

60.4 b/c

1.8 × 102

3.3 × 102

48.13

C7225

17.3 b/c

1.2 × 108

2.3 × 105

51.44

C7236

18.9 b/c

1.4 × 108

2.0 × 105

46.9

C7230

12.6 b/c

3.2 × 104

4.4 × 103

46.47

Determination of E. coli strains as belonging to the AIEC pathotype was performed using the following criteria: (1) the ability to adhere to HeLa cells with an adhesion index equal or superior to 1 bacteria per cell (b/c), (2) the ability of the bacteria to invade HeLa cells with an invasion index equal or superior to 0.1% of the original inoculum, (3) the ability to survive and to replicate within J774 macrophages

aAdherence rate is expressed as the mean of bacteria adhered to one HeLa cell

bInvasion is the mean CFUs after 1 h rifampicin treatment of infected HeLa cells

cMean of intracellular bacteria at 3 h post infection relative to the number after 1 h rifampicin treatment, defined as 100% (MOI of 100)

dBiofilm formation rate is defined as milligrams per grams of total protein

Biofilm formation of E. coli ST131 O25:H4/H30-Rx clones

Biofilm formation has been suggested as another feature of AIEC strains [54]. Here we tested if the four E. coli ST131 O25:H4/H30-Rx strains formed higher biofilms than non AIEC strains. Our results showed homogeneity in biofilm formation among the four strains (from 46 to 51 mg of biofilm/gr of total protein) which were higher but close to EPEC (37.3 mg), EHEC (47.58 mg) and ETEC (47.96). Interestingly, the four tested strains showed a lightly higher biofilm formation phenotype than UPEC (41.19 mg) and EAEC (47.64 mg) (Fig. 3b).

E. coli ST131 O25:H4/H30-Rx strains harbors AIEC genetic determinants

We further examined E. coli ST131 O25:H4/H30-Rx strains for the presence of five genes of AIEC strains and widely characterized in the typical strains (NRG857C and LF82) [42, 49, 55, 56]. We amplified the insA, insB, ibeA, intI1 and vat genes, and found that all four strains tested were positive for the insA, insB and intI1 genes. None of the four strains carries ibeA and vat genes (Table 1). The non-pathogenic strain E. coli C600 was used as a negative control. These results indicate that the four E. coli ST131 O25:H4/H30-Rx strains we tested share genetic determinants similar with the AIEC strains previously characterized [42, 43, 49, 55, 56].

Discussion

It is well documented that patients infected with ESBL-producing microorganisms have been erroneously cephalosporin treated or spent long time at hospital facilities, increasing the risk of develop selective pressure or acquiring resistant clones [57]. Interestingly healthy donors’ strains have shown resistance to β-lactamic, aminoglycosides and tetracycline. The high prevalence of CTX-M-15 and CTX-M-14 that can be carried in plasmid, indicates that could be acquired by clonal dissemination. This clones have been reported in healthy humans in Spain, Tunisia, China and The Netherlands but there is only two reports from Latin America [12, 50, 5861].

There are reports indicating that E. coli ST131-B2 are multi-drug resistant, harboring plasmids carrying on blaCTX-M-15 gene from clinical samples, healthy humans and soil isolates [8, 12, 62, 63]. The four strains tested belong to O25:H4 serotype and fimH 30 variant, as they showed β-lactamase and quinolone resistance belonging to a subclone ST131-B2-O25:H4/H30-Rx, which is recognized for increasing rates of morbidity, mortality and costs in the clinical area and community [11]. Strains belonging to O25:H4 serotype are usually related with high virulence rates, and here we identified two new virotypes with different genetic arrangements, suggesting an endemic distribution of virulence genes probably acquired by MGEs. We also detected genes related to ExPEC strains used as PAI markers, which would explain the high virulence reported for ST131 strains [8, 62]. Nevertheless, it has been proposed that acquisition of virulence gene determinants such as afa/draBC, afa operon, iroN, sat, ibeA, papGII, cnf1, hlyA, papGIII, cdtB or neuC-K1 in ST131 strains was prior to the development of resistance to fluoroquinolones, causing this clone to emerge steadily, first acquiring genes associated with its ability to cause infections in humans and then endowing itself with an arsenal of antimicrobial resistance that has trigger its massive expansion worldwide [11, 64]. When we looked for specific pathotype genes, PAI-I and II from UPEC CFT073 were identified in three of the four strains (C7225, C7226, C7230), additionally the fact that strain C7223 had a different ST could explain the variability of housekeeping genes tested when determining sequence typing; however, despite of the belonging to specific virotypes, we were not able to correlate resistance with virulence pattern.

AIEC recently described, are not associated with diarrhea, and instead they are thought to contribute to the development of chronic inflammatory bowel diseases such as in the case of Crohn’s disease and ulcerative colitis. AIEC strains can be identified by their ability to adhere to and invade epithelial cells and to replicate within macrophages and for harboring genetic determinants as insA, insB, intI1, ibeA and vat [42, 49, 55, 56, 65]. Analysis of whole genome sequences of several AIEC isolates had shown that the AIEC phenotype may not be due to one or more specific virulence determinants, suggesting that the distinctive phenotype of these bacteria may result from metabolic processes that enhances growth in tissues affected by Crohn’s disease. Thus, although AIEC are recovered more commonly from patients with Crohn’s disease than from healthy people, we identified four strains from healthy donors that did not referred any symptoms at the time of collecting the sample, nevertheless, it is common for the Mexican population to have food consumption habits with a high amount of irritants such as alcohol and spice which could predispose to inflammatory conditions, that together with this type of bacteria complicate the development of the illness supporting dysbiosis events that have been recently proposed [48].

In this study, we determined that the four strains survived differentially within macrophages. This trait has been related to ompA and ompC expression [66], so it will be interesting, in future experiments, to look for the expression of these genes in the four strains under infection conditions. Recently, have been reported the rise of strains that show increased catalytic efficiencies toward extended-spectrum cephalosporin known as ESAC (extended-spectrum AmpC) producing strains [67], evidence suggests the loss of OmpC and OmpF porins but also mutations at ampC promoter level; interestingly, three of the four strains tested showed cefepime resistance what makes them candidates to ESAC-producing E. coli, then it will be interesting too, in future experiments, to determine the sequence changes and to evaluate it with mutagenesis-complementation assays. Furthermore, biofilms are communities of microbes attached to surfaces and have a few distinct characteristics; they are typically surrounded by an extracellular matrix that provides structure and protection to the community; bacteria growing in a biofilm also have a characteristic architecture generally comprised of macrocolonies containing thousands of cells surrounded by fluid-filled channels; biofilm-grown bacteria are also notorious for their resistance to a range of antimicrobial agents including clinically relevant antibiotics [54]. Previous work showed a higher to form biofilm capacity amongst AIEC than non-AIEC strains, suggesting this feature as an important determinant involved into AIEC pathogenesis [54]. Our four strains showed high rates of fluoroquinolone resistance [50] only detecting punctual mutations in gyrA and parC genes; it can be explained by its biofilm formation capability, however, the biofilm formation rates of the four tested strains were similar to those showed by the control strains, so we cannot consider it as an indicative characteristic of AIEC pathotype. It would be interesting to extend the research of this pathotype to other sources (such as urine), since these strains harbor pathogenic determinants that could confer them the ability to invade/colonize which could lead to a clinical picture.

To our knowledge, this report represents the first characterization of AIEC in Mexico and the first time these strains are isolated from healthy donors; moreover, it is the first detection of an AIEC strain related to ST131 clone. This, together with the findings of new virotypes, highlights the importance of these strains as reservoirs or carriers of MDR and highly infective strains that could be transmitted to vulnerable population.

Declarations

Authors’ contributions

All authors read and approved the final manuscript.

Acknowledgements

We thank A.G. Torres from UTMB for his guidance and support during the performance of this work. We thank V. Vallejo-Ruiz and G. Santos-López from CIBIOR-IMSS and V. Ortíz-Navarrete from CINVESTAV-IPN for HeLa and J774 cell lines donation, respectively.

Competing interests

The authors declare that they have no competing interests.

Availability of data

Please contact author for data request.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Funding

This work was supported by the VIEP of the Benemérita Universidad Autónoma de Puebla, [ROGR/NAT17-G and ARHM/NAT/17] and for CONACYT México [CB 2017-2018-A1-S-22136]. Edwin Barrios Villa had a scholarship from CONACYT (number 411957), Gerardo Cortés Cortés had a scholarship of CONACYT (number 233611).

Informed consent

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Benemérita Universidad Autónoma de Puebla, Posgrado en Ciencias Microbiológicas, Centro de Investigaciones en Ciencias Microbiológicas, Instituto de Ciencias, Puebla, Mexico
(2)
Área de Bioquímica y Biología Molecular, Universidad de La Rioja, Logroño, Spain

References

  1. Melnyk AH, Wong A, Kassen R. The fitness costs of antibiotic resistance mutations. Evol Appl. 2015;8:273–83.View ArticleGoogle Scholar
  2. Roux D, Danilchanka O, Guillard T, et al. Fitness cost of antibiotic susceptibility during bacterial infection. Sci Transl Med. 2015;7:297ra114.View ArticleGoogle Scholar
  3. Guillard T, Pons S, Roux D, Pier GB, Skurnik D. Antibiotic resistance and virulence: understanding the link and its consequences for prophylaxis and therapy. BioEssays. 2016;38:682–93.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Davies SC. Annual report of the Chief Medical Officer, vol 2; 2011, Infections and the rise of antimicrobial resistance (Chapter 5). London: Department of Health. 2013; p. 73–86.Google Scholar
  5. Laxminarayan R, Duse A, Wattal C, et al. Antibiotic resistance-the need for global solutions. Lancet Infect Dis. 2013;13:1057–98.View ArticleGoogle Scholar
  6. Hawkey PM. Multidrug-resistant Gram-negative bacteria: a product of globalization. J Hosp Infect. 2015;89:241–7.View ArticleGoogle Scholar
  7. Canton R, Coque TM. The CTX-M beta-lactamase pandemic. Curr Opin Microbiol. 2006;9:466–975.View ArticleGoogle Scholar
  8. Mora A, Dahbi G, López C, et al. Virulence patterns in a murine sepsis model of ST131 Escherichia coli clinical isolates belonging to serotypes O25b:h4 and O16:H5 are associated to specific virotypes. PLoS ONE. 2014;9:e87025.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Price LB, Johnson JR, Aziz M, et al. The epidemic of extended-spectrum-β-lactamase-producing Escherichia coli ST131 is driven by a single highly pathogenic subclone, H30-Rx. mBio. 2013;4:e00377-13.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Banerjee R, Johnson JR. A new clone sweeps clean: the enigmatic emergence of Escherichia coli sequence type 131. Antimicrob Agents Chemother. 2014;58:4997–5004.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Nicolas-Chanoine MH, Bertrand X, Madec JY. Escherichia coli ST131, an intriguing clonal group. Clin Microbiol Rev. 2014;27:543–74.View ArticlePubMedPubMed CentralGoogle Scholar
  12. den Reijer PM, van Burgh S, Burggraafl A, Ossewaarde JM, van der Zee A. The widespread presence of a multidrug-resistant Escherichia coli ST131 clade among community-associated and hospitalized patients. PLoS ONE. 2016;11:1–13.Google Scholar
  13. Coque TM, Baquero F, Canton R. Increasing prevalence of ESBL producing Enterobacteriaceae in Europe. Euro Surveill. 2008;13:pii19044.Google Scholar
  14. Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, et al. Intercontinental emergence of Escherichia coli clone O25:H4- ST131 producing CTX-M-15. J Antimicrob Chemother. 2008;61:273–81.View ArticlePubMedGoogle Scholar
  15. Coque TM, Novais A, Carattoli A, et al. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum β-lactamase CTX-M-15. Emerg Infect Dis. 2008;14:195–200.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Johnson JR, Brian J, Connie C, Kuskowski MA, Mariana C. Escherichia coli sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United States. Clin Infect Dis. 2010;51:286–94.View ArticlePubMedGoogle Scholar
  17. Gomi R, Matsuda T, Matsumura Y, Tanaka M, Ichiyama S, Yoneda M. Ocurrence of Clinically important lineages, including the ST131 C1-M27 subclone, among extended-spectrum β-lactamase-producing Echerichia coli in wastewater. Antimicrob Agents Chemother. 2017. https://doi.org/10.1128/aac.00564-17.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Namaei MH, Yousefi M, Ziaee M, Salehabadi A, Ghannadkafi M, Amini E, Askari P. First report of prevalence of CTX-M-15-producing Escherichia coli O25b/ST131 from Iran. Microb drug Resist. 2017. https://doi.org/10.1089/mdr.2016.0272.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Clermont O, Christenson JK, Denamur E, Gordon DM. The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep. 2013;5:58–65.View ArticlePubMedGoogle Scholar
  20. Le Gall T, Clermont O, Gouriou S, et al. Extraintestinal virulence is a coincidental by-product of commensalism in B2 phylogenetic group Escherichia coli strains. Mol Biol Evol. 2007;24:2373–84.View ArticlePubMedGoogle Scholar
  21. Dahbi G, Mora A, Lopez C, et al. Emergence of new variants of ST131 clonal group among extraintestinal pathogenic Escherichia coli producing extended-spectrum β-lactamases Int. J Antimicrob Agents. 2013;42:347–51.View ArticleGoogle Scholar
  22. Matsumura Y, Yamamoto M, Nagao M, et al. Emergence and spread of B2-ST131- O25b, B2-ST131-O16 and D-ST405 clonal groups among extended spectrum β-lactamase-producing Escherichia coli in Japan. J Antimicrob Chemother. 2012;67:2612–20.View ArticlePubMedGoogle Scholar
  23. Olesen B, Hansen DS, Nilsson F, et al. Prevalence and characteristics of the epidemic multiresistant Escherichia coli ST131 clonal group among extended-spectrum β-lactamase-producing E. coli isolates in Copenhagen. Denmark. J Clin Microbiol. 2013;51:1779–85.View ArticlePubMedGoogle Scholar
  24. Platell JL, Cobbold RN, Johnson JR, et al. Commonality among fluoroquinolone resistant sequence type ST131 extraintestinal Escherichia coli isolates from humans and companion animals in Australia. Antimicrob Agents Chemother. 2011;55:3782–7.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Kudinha T, Johnson JR, Andrew S, Kong F, Anderson P, Gilbert GL. Escherichia coli sequence type 131 (ST131) as a prominent cause of antibiotic resistance among urinary Escherichia coli isolates from reproductive-age women. J Clin Microbiol. 2013;51:3270–6.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Habeeb MA, Haque A, Iversen A, Giske CG. Occurrence of virulence genes, 16S rRNA methylases, and plasmid mediated quinolone resistance genes in CTX-M-producing Escherichia coli from Pakistan. Eur J Clin Microbiol Infect Dis. 2013;33:399–409.View ArticlePubMedGoogle Scholar
  27. Blanc V, Leflon-Guibout V, Blanco J, et al. Prevalence of day-care centre children (France) with faecal CTX-M-producing Escherichia coli comprising O25b:H4 and O16:H5 ST131 strains. J Antimicrob Chemother. 2014;69:1231–7.View ArticlePubMedGoogle Scholar
  28. Russo TA, Johnson JR. Proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli: ExPEC. J Infect Dis. 2000;181:1753–4.View ArticlePubMedGoogle Scholar
  29. van der Bij AK, Peirano G, Pitondo Silva A, Pitout JDD. The presence of genes encoding for different virulence factors in clonally related Escherichia coli that produce CTX-Ms. Diagn Microbiol Infect Dis. 2012;72:297–302.View ArticlePubMedGoogle Scholar
  30. Gibreel TM, Dodgson AR, Cheesbrough J, Fox AJ, Bolton FJ, Upton M. Population structure, virulence potential and antibiotic susceptibility of uropathogenic Escherichia coli from Northwest England. J Antimicrob Chemother. 2012;67:346–56.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Adams-Sapper S, Diep BA, Perdreau-Remington F, Riley LW. Clonal composition and community clustering of drug-susceptible and -resistant Escherichia coli isolates from bloodstream infections. Antimicrob Agents Chemother. 2013;57:490–7.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Williamson DA, Freeman JT, Porter S, et al. Clinical and molecular correlates of virulence in Escherichia coli causing bloodstream infection following transrectal ultrasound-guided (TRUS) prostate biopsy. J Antimicrob Chemother. 2013;68:2898–906.View ArticleGoogle Scholar
  33. Lopez-Cerero L, Navarro MD, Bellido M, et al. Escherichia coli belonging to the worldwide emerging epidemic clonal group O25b/ST131: risk factors and clinical implications. J Antimicrob Chemother. 2013;69:809–14.View ArticleGoogle Scholar
  34. Assimacopoulos A, Johnston B, Clabots C, Johnson JR. Postprostate biopsy infection with Escherichia coli ST131 leading to epididymo-orchitis and meningitis caused by Gram-negative bacilli. J Clin Microbiol. 2012;50:4157–9.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Johnson JR, Anderson JT, Clabots C, Johnston B, Cooperstock M. Within-household sharing of a fluoroquinolone-resistant Escherichia coli sequence type ST131 strain causing pediatric osteoarticular infection. Pediatr Infect Dis J. 2010;29:473–5.View ArticleGoogle Scholar
  36. Vigil KJ, Johnson JR, Johnston BD, et al. Escherichia coli pyomyositis: an emerging infectious disease among patients with hematologic malignancies. Clin Infect Dis. 2010;50:374–80.View ArticleGoogle Scholar
  37. Ender PT, Gajanana D, Johnston B, Clabots C, Tamarkin FJ, Johnson JR. Transmission of an extended-spectrum-β-lactamase producing Escherichia coli (sequence type ST131) strain between a father and daughter resulting in septic shock and emphysematous pyelonephritis. J Clin Microbiol. 2009;47:3780–2.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Owens RCJ, Johnson JR, Stogsdill P, Yarmus L, Lolans K, Quinn J. Community transmission in the United States of a CTX-M-15-producing sequence type ST131 Escherichia coli strain resulting in death. J Clin Microbiol. 2011;49:3406–8.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Kaper JB, Nataro J, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123–40.View ArticleGoogle Scholar
  40. Gomes TAT, Elias WP, Scaletsky ICA, et al. Diarrheagenic Escherichia coli. B J Microbiol. 2016;47S:3–30.View ArticleGoogle Scholar
  41. Russo TA, Johnson JR. Medical and economic impact of extraintestinal infections due to Escherichia coli: an overlook epidemic. Microbes Infect. 2003;5:449–56.View ArticlePubMedGoogle Scholar
  42. Eaves-Pyles T, Allen CA, Taormina J, et al. Escherichia coli isolated from a Crohn’s disease patient adheres, invades, and induces inflammatory responses in polarized intestinal epithelial cells. Int J Med Microbiol. 2008;298:397–409.View ArticlePubMedGoogle Scholar
  43. Darfeuille-Michaud A, Colombel JF. Pathogenic Escherichia coli in inflammatory bowel diseases. J Crohns Colitis. 2008;2:255–62.View ArticlePubMedGoogle Scholar
  44. Subramanian S, Roberts CL, Hart CA, et al. Replication of colonic Crohn’s disease mucosal Escherichia coli isolates within macrophages and their susceptibility to antibiotics. Antimicrob Agents Chemother. 2008;52:427–34.View ArticlePubMedGoogle Scholar
  45. Barnich N. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. J Clin Invest. 2007;117:1566–74.View ArticlePubMedPubMed CentralGoogle Scholar
  46. Carvalho FA, Barnich N, Sivignon A, et al. Crohn’s disease adherent-invasive Escherichia coli colonize and induce strong gut inflammation in transgenic mice expressing human CEACAM. J Exp Med. 2009;206:2179–89.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Nilsson LM, Thomas WE, Sokurenko EV, Vogel V. Elevated shear stress protects Escherichia coli cells adhering to surfaces via catch bonds from detachment by soluble inhibitors. Appl Environ Microbiol. 2006;72:3005–10.View ArticlePubMedPubMed CentralGoogle Scholar
  48. Martínez-de la Peña CF, Armstrong GD, Arenas-Hernández MMP, Cieza RJ. Homeostasis vs dysbiosis: role of commensal Escherichia coli in disease. In: Torres AG, editor. Escherichia coli in the Americas. 1st ed. Berlin: Springer International Publishing Group; 2016. p. 281–99.View ArticleGoogle Scholar
  49. Gibold L, Gareanux E, Dalmasso G, et al. The vat-AIEC protease promotes crossing of the intestinal mucus layer by Crohn’s disease-associated Escherichia coli. Cell Microbiol. 2016;18:617–31.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Cortés-Cortés G, Lozano-Zaraín P, Torres C, et al. Extended-spectrum β-lactamase-producing E. coli isolated from healthy humans in México, including subclone ST131-B2-O25:H4-H30-Rx. J Glob Antimicrob Resist. 2017;9:130–4.View ArticlePubMedGoogle Scholar
  51. O’Toole GA. Microtiter Dish Biofilm Formation Assay. JoVE. 2011;47:1. https://doi.org/10.3791/2437.View ArticleGoogle Scholar
  52. Huerta JM, Aguilar I, López-Pliego L, Fuentes-Ramírez LE, Castañeda M. The role of the ncRNA RgsA in the oxidative stress response and Biofilm formation in Azotobacter vinelandii. Curr Microbiol. 2016;72:671–9.View ArticlePubMedGoogle Scholar
  53. Aldred KJ, Kerns RJ, Osheroff N. Mechanism of quinolone action and resistance. Biochemistry. 2014;53:1565–74.View ArticlePubMedPubMed CentralGoogle Scholar
  54. Martínez-Medina M, Naves O, Blanco J, et al. Biofilm formation as a novel phenotypic feature of adherent-invasive Escherichia coli (AIEC). BMC Microbiol. 2009;9:202.View ArticlePubMedPubMed CentralGoogle Scholar
  55. Cieza RJ, Hu J, Ross BN, Sbrana E, Torres AG. The IbeA invasin of adherent-invasive Escherichia coli mediates interaction with intestinal epithelia and macrophages. Infect Immun. 2015;83:1904–18.View ArticlePubMedPubMed CentralGoogle Scholar
  56. O’Brien CL, Bringer MA, Holt KE, et al. Comparative genomics of Crohn’s disease-associated adherent-invasive Escherichia coli. Gut. 2016;66:1–8.Google Scholar
  57. Benner KW, Prabhakaran P, Lowros AS. Epidemiology of infections due to extended- spectrum Beta-lactamase-producing bacteria in a pediatric intensive care unit. J Pediatr Pharmacol Ther. 2014;19:83–90.PubMedPubMed CentralGoogle Scholar
  58. Vinué L, Sáenz Y, Martínez S, et al. Prevalence and diversity of extended-spectrum beta-lactamases in faecal Escherichia coli isolates from healthy humans in Spain. Clin Microbiol Infect. 2009;15:954–7.View ArticlePubMedGoogle Scholar
  59. Ben Sallem R, Ben Slama K, Estepa V, et al. Prevalence and characterisation of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli isolates in healthy volunteers in Tunisia. Eur J Clin Microbiol Infect Dis. 2012;31:1511–6.View ArticlePubMedGoogle Scholar
  60. Zhang H, Zhou Y, Guo S, Chang W. High prevalence and risk factors of fecal carriage of CTX-M type extended-spectrum beta-lactamase-producing Enterobacteriaceae from healthy rural residents of Taiwan, China. Front Microbiol. 2015;6:239.PubMedPubMed CentralGoogle Scholar
  61. Pallecchi L, Bartoloni A, Fiorelli C, et al. Rapid dissemination and diversity of CTX-M extended-spectrum beta-lactamase genes in commensal Escherichia coli isolates from healthy children from low-resource settings in Latin America. Antimicrob Agents Chemother. 2007;51:2720–5.View ArticlePubMedPubMed CentralGoogle Scholar
  62. Olesen B, Frimodt-Møller J, Leihof RF, et al. Temporal trends in antimicrobial resistance and virulence-associated traits within the Escherichia coli sequence type 131 clonal group and its H30 and H30-Rx subclones, 1968 to 2012. Antimicrob Agents Chemother. 2014;58:6886–95.View ArticlePubMedPubMed CentralGoogle Scholar
  63. Ben Said L, Jouini A, Klibi N, et al. Detection of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in vegetables, soil and water of the farm environment in Tunisia. Int J Food Microbiol. 2015;203:86–92.View ArticlePubMedGoogle Scholar
  64. Ben Zakour NL, Alsheikh-Hussain AS, Ashcroft MM, et al. Sequential acquisition of virulence and fluoroquinolone resistance has shaped the evolution of Escherichia coli ST131. MBio. 2016;7:e00347-16.View ArticlePubMedPubMed CentralGoogle Scholar
  65. Martínez-Medina M, Mora A, Blanco M, et al. Similarity and divergence among invasive-adherent Escherichia coli and extraintestinal pathogenic E. coli strains. J Clin Microbiol. 2009;47(12):3968–79.View ArticlePubMedPubMed CentralGoogle Scholar
  66. Sepehri S, Khafipour E, Bernstein CN, et al. Characterization of Escherichia coli isolated from gut biopsies of newly diagnosed patients with Inflammatory Bowel Disease. Inflamm Bowel Dis. 2011;17:1451–60.View ArticlePubMedGoogle Scholar
  67. Mammeri H, Nordmann P, Berkani A, Eb F. Contribution of extended-spectrum AmpC (ESAC) β-lactamases to carbapenem resistance Escherichia coli. FEMS Microbiol Lett. 2008;282:238–40.View ArticlePubMedGoogle Scholar
  68. Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis. 2000;181:261–72.View ArticlePubMedGoogle Scholar
  69. Sabaté M, Moreno E, Pérez T, Andreu A, Prats G. Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Clin Microbiol Infect. 2006;12:880–6.View ArticlePubMedGoogle Scholar
  70. Landraud L, Gibert M, Popoff MR, Boquet P, Gauthier M. Expression of cnf1 by Escherichia coli J96 involves a large upstream DNA region including the hlyCABD operon, and is regulated by the RfaH protein. Mol Microbiol. 2003;47:1653–67.View ArticleGoogle Scholar
  71. Batchelor M, Clifton-Hadley FA, Stallwood AD, Paiba GA, Davies RH, Liebana E. Detection of multiple cephalosporin-resistant Escherichia coli from a cattle fecal sample in Great Britain. Microb Drug Resist. 2005;11:58–61.View ArticleGoogle Scholar
  72. Blanco M, Alonso MP, Nicolas-Chanoine MH, Dahbi G, Mora A, Blanco JE, et al. Molecular epidemiology of Escherichia coli producing extended-spectrum b-lactamases in Lugo (Spain): dissemination of clone O25b:H4-ST131 producing CTX-M-15. J Antimicrob Chemother. 2009;63:1135–41.View ArticleGoogle Scholar
  73. Yamamoto S, Terai A, Yuri K, Kurazono H, Takeda Y, Yoshida O. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immunol Med Microbiol. 1995;12:85–90.View ArticlePubMedPubMed CentralGoogle Scholar
  74. Mazel D, Dychinco B, Webb VA, Davies J. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother. 2000;44:1568–74.View ArticlePubMedPubMed CentralGoogle Scholar
  75. Rashid RA, Tarr PI, Moseley SL. Expression of the Escherichia coli IrgA homolo adhesion is regulated by the ferric uptake regulation protein. Microb Pathoh. 2006;41(6):207–17.View ArticleGoogle Scholar
  76. Mansan-Almeida R, Leite A, Gimenes L. Diffusely adherent Escherichia coli strains isolated from children and adults constitute two different populations. BMC Microbiol. 2013;13:22.View ArticlePubMedPubMed CentralGoogle Scholar
  77. Vargas M, Gascón J, Gallardo F, Jiménez de Anta MT, Vila J. Prevalence of Escherichia coli strains detected by PCR in patients with travelers’ diarrhea. Clin Microbiol Infect. 1998;4:682–8.View ArticleGoogle Scholar
  78. Rodríguez-Angeles G. Principales características y diagnóstico de los grupos patógenos de Escherichia coli. Salud Publica Mex. 2002;44:464–75.View ArticleGoogle Scholar
  79. Gunzburg ST, Tornieporth NG, Riley LW. Identification of enteropathogenic Escherichia coli by PCR-based detection of the bundleforming pilus gene. J Clin Microbiol. 1995;33:1375–7.PubMedPubMed CentralGoogle Scholar
  80. Gannon VP, Rashed M, King RK, Thomas EJ. Detection and characterization of the eae gene of Shiga-like toxin-producing Escherichia coli using polymerase chain reaction. J Clin Microbiol. 1993;31:1268–74.PubMedPubMed CentralGoogle Scholar
  81. Fratamico PM, Sackitey SK, Wiedmann M, Deng MY. Detection of Escherichia coli O157:H7 by multiplex PCR. J Clin Microbiol. 1995;33:2188–91.PubMedPubMed CentralGoogle Scholar
  82. Bassa A, Dadie A, Guessennd N, Gbonon V, Dako E, Dje M, et al. Virulence factors and resistance profile of Shigella isolated during infectious diarrhea in Abidjan, Cote D’Ivoire. J Appl Sci Res. 2010;6:594–9.Google Scholar
  83. Franke J, Franke S, Schmidt H, Schwarzkopf A, Wieler LH, Baljer J, et al. Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol. 1994;32:2460–3.PubMedPubMed CentralGoogle Scholar
  84. Schmidt H, Knop C, Franke S, Aleksic S, Heeseman J, Karch H. Development of PCR for screening of enteroaggregative Escherichia coli. J Clin Microbiol. 1995;33:701–5.PubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s) 2018

Advertisement