Skip to main content

Table 2 Specific primers used in this study

From: Adherent/invasive Escherichia coli (AIEC) isolates from asymptomatic people: new E. coli ST131 O25:H4/H30-Rx virotypes

Target Primer name Sequence 5′ to 3′ Tm ( °C) Amplicon size Reference
PAI-ICFT073 RPAi GGACATCCTGTTACAGCGCGCA 65 925 bp [68]
RPAf TCGCCACCAATCACAGCGAAC
PAI-IICFT073 Cft073.2Ent1 ATGGATGTTGTATCGCGC 55 400 bp [69]
cft073.2Ent2 ACGAGCATGTGGATCTGC
PAI-IJ96 PapGIf TCGTGCTCAGGTCCGGAATTT 57.7 400 bp [68]
PapGIr TGGCATCCCACATTATCG
PAI-IIJ96 Hlyd GGATCCATGAAAACATGGTTAATGGG 59.3 2.3 kb [70]
Cnf GATATTTTTGTTGCCATTGGTTACC
fimH FimH-F CACTCAGGGAACCATTCAGGCA 57 975 bp [71]
FimH-R CTTATTGATAAACAAAAGTCAC
Iron IRON-F AAGTCAAAGCAGGGGTTGCCCG 60 667 bp [16]
IRON-R GACGCCGACATTAAGACGCAG
afa operon AFA025-F GAGTCACGGCAGTCGCGGCGG 55 207 bp [72]
AFA025-R TTCACCGGCGACCAGCCATCTCC
afa/draBC Afa-DraF GGCAGAGGGCCGGCAACAGGC 60 559 bp [68]
Afa-DraR CCCGTAACGCGCCAGCATCTC
ibeA IBEA 10 F AGGCAGGTGTGCGCCGCGTAC 60 170 bp [68]
IBEA 10 R TGGTGCTCCGGCAAACCATGC
cnfI cnf-f ATCTTATACTGGATGGGATCATCTTGG 60 974 bp [73]
cnf-r GCAGAACGACGTTCTTCATAAGTAT
cdtB cdtB-f AACTGATTTTCGCGTTGCGA 60 741 bp This study
cdtB-r GATACGCCAACAGGGAAATG
neuC-KI kpsII-f GATACGCCAACAGGGAAATG 63 272 bp [68]
kpsII-r CATCCAGACGATAAGCATGAGCA
KI-f TAGCAAACGTTCTATTGGTGC 153 bp
insA insA-f GGCATCCAACGCCATTCAT 62 178 bp This study
insA-r TGTCCCTCCTGTTCAGCTACTGA
insB insB-f ATGTTCAGATAATGCCCGATG 62 461 bp This study
insB-r CGTTGGCCTCAACACGATTT
vatA vatA1076F CCTGGGACATAATGGTCAGAT 61 330 bp Arenas-Hernández unpublished data
vatA1406R CTGGCAATATTCACGCTACTG
vatP vatP-86F TAGCGCGCAATTCAACAATA 61 226 bp Arenas-Hernández unpublished data
vatP226R GCAGATAGTGCCAGAGAGGTAAG
intI1 IntI1-F GGGTCAAGGATCTGGATTTCG 62 483 bp [74]
IntI1-R CGACGATGATTTACACGCATGT
papa papA-45F CAGATATCTCGGTGTGTTCAGTAA 61 641 bp Arenas-Hernández unpublished data
papA + 31R GGTCTTGCCTCACCCTGTAA
iha ihaEMSAR CGGAATTCCGATCTCCGATCATGTTAACCG 61 150 bp [75]
ihaEMSAL CGGAATTCCGGCATGCCGAGGCAGTCGTTA
iucD iucD-30F GCTGTGGCTGGTAACTCAGG 58 512 bp Arenas-Hernández unpublished data
iucD512R TGCTTCACACAGGGTGGTAAAT
fliC FliC 242F GCTGTCCGAAATCAACAACAA 58 304 bp Arenas-Hernández unpublished data
FliC 445 R GGCTATCGTACCGGAACCATT
Fimbrial adhesin subunit daaE-F TGACTGTGACCGAAGAGTGC 48 380 bp [76]
daaE-R TTAGTTCGTCCAGTAACCCCC
IS3 Transposase family STI-F TTAATAGCACCCGGTACAAGCAGG 64 147 bp [77]
STI-R CTTGACTTCTTCAAAAGAGAAAATTAC
Heat-stable enterotoxin STaII-F TTGTCTTTTTCACCTTTCCC 60 93 bp [78]
STaII-R ACAAGCAGGATTACAACACA
Heat-labile enterotoxin LT-F GGCGACAGATTATACCGTGC 60 750 bp [79]
LT-R CCGAATTCTGTTATAATATGTC
Intimin eae-F CAGGTCGTCGTGTCTGCTAAA 67 1087 bp [80]
eae-R TCAGCGTGGTTGGATCAACCT
Shiga toxin 1 STx1-F TTTACGATAGACTTCTCGAC 55 227 bp [81]
STx2-R CACATATAAATTATTTCGCTC
Shiga toxin 2 STx2-F CCCAGTCACGACGTTGTA 60 460 bp [78]
STx2-R TATACTATCGTGCCTTTCCA
ial ial-F CTGGATGGTATGGTGAGG 60 320 bp [82]
ial-R GGAGGCCAACAATTATTTCC
EAF EAF-F CAGGGTAAAAGAAAGATGATAA 58 1087 bp [83]
EAF-R TATGGGGACCATGTATTATCA
bfpA bfpA-F AATGGTGCTTGCGCTTGCTGC 67 326 bp [79]
bfpA-R GCCGCTTTATCCAACCTGGTA
EAEC plasmid EAEC-F CTGGCGAAAGACTGTATCAT 60 630 bp [84]
EAEC-R CAATGTATAGAAATCGCTGTT