Skip to content

Advertisement

  • Research
  • Open Access

Genetic contexts related to the diffusion of plasmid-mediated CTX-M-55 extended-spectrum beta-lactamase isolated from Enterobacteriaceae in China

  • 1,
  • 1, 2Email author,
  • 1, 2,
  • 3,
  • 1,
  • 4,
  • 1,
  • 1 and
  • 1
Contributed equally
Annals of Clinical Microbiology and Antimicrobials201817:12

https://doi.org/10.1186/s12941-018-0265-x

  • Received: 25 December 2016
  • Accepted: 9 March 2018
  • Published:

Abstract

Background

CTX-M-55 extended-spectrum beta-lactamases are being rapidly disseminated and transmitted in clinical practices around the world. The genetic contexts of the transferable plasmid-mediated blaCTX-M-55 gene in Enterobacteriaceae were detected and characterized in this study.

Methods

Isolates were obtained from the First Affiliated Hospital of Zhengzhou University between September 2015 and March 2016. Based on polymerase chain reaction and BLAST analysis, resistance genes and genetic context of the blaCTX-M-55 gene were investigated. Conjugation experiments and multilocus sequence typing were performed to demonstrate plasmid-mediated blaCTX-M-55 transmission.

Results

Thirteen blaCTX-M-55-positive isolates of Enterobacteriaceae were obtained. Seven isolates were Escherichia coli, 3 were Klebsiella pneumoniae, 1 was Citrobacter freundii, 1 was Morganella morganii and 1 was Serratia marcescens. The blaCTX-M-55 gene has not previously been identified from C. freundii and M. morganii. Four different blaCTX-M-55 genetic contexts were identified, and all of them harbored ISEcp1 in the region upstream of blaCTX-M-55 (in two cases, ISEcp1 was truncated by IS26, and in one case, it was truncated by IS1294), whereas ORF477 was detected downstream of the blaCTX-M-55 gene from 12 of 13 strains. The novel genetic context of ISEcp1∆-blaCTX-M-55-∆IS903 was firstly detected the IS903 element which was identified downstream of blaCTX-M-55. A conjugation assay revealed that all blaCTX-M-55 plasmids were quickly and easily transferable to recipient E. coli, which then presented resistance to multiple antibiotics.

Conclusions

Numerous blaCTX-M-55-positive strains were isolated in a short period of 7 months. The findings indicate that blaCTX-M-55 was rapidly disseminated. The genetic context and conjugative transfer found in this study demonstrate that there is active transmission of blaCTX-M-55 among strains of Enterobacteriaceae in China, which could give rise to an urgent global public health threat.

Keywords

  • bla CTX-M-55
  • Enterobacteriaceae
  • ISEcp1

Background

Since the first reports of CTX-M extended-spectrum beta-lactamases (ESBLs) in 1989 [1], at least 26 bacterial species across the world have been referenced in the “CTX-M pandemic” [2]. More than 190 diverse variants of CTX-M have been recorded to date. Among these variants, CTX-M-55 pertains to the CTX-M-1 cluster, which is a variant of CTX-M-15 with only one amino acid substitution (Ala-80-Val) [3]. This variant was first reported in 2006 [4] and was identified in Thailand as well as in the UK [35]. Over the past decade, the isolate rate of CTX-M-55 in Escherichia coli from animals has been increasingly raised. However, CTX-M-55 was not identified in clinical practices in China until 2010, when it was detected from a person who traveled to China [6]. Since then, plenty of surveys have confirmed the emergence of blaCTX-M-55 among clinical pathogenic in China [711].

Conjugative plasmids are one of the most important mechanisms for the appearance and spread of blaCTX-M. These plasmids facilitate horizontal transfer to other isolates and even cross-species barriers [12]. Insertion sequences (ISs), which cause insertion mutations and genome rearrangements, are the smallest mobile elements (< 2.5 Kb) independent transposition in an organism and competent to promote translocation, and the transferability of a resistance gene will largely increased under the mediated of ISs [13]. Various types of genetic platforms are associated with blaCTX-M genes, and ISEcp1 is frequently recorded upstream of blaCTX-M. ISEcp1 can transpose the blaCTX-M gene and act as a strong activator for the high expression of it [12, 14, 15]. In addition, other insertion sequences, including IS26, IS903 and ORF477, are also frequently detected surrounding blaCTX-M [16, 17].

Thus, this study intends to inquire into the prevalent trend of blaCTX-M-55 genes and their transferability and genetic contexts among clinical strains in Henan Province in central China.

Methods

Bacterial isolates, antimicrobial susceptibility testing and ESBLs confirmation

Total number of 227 unduplicated ESBL-positive Enterobacteriaceae [Escherichia coli (n = 93), Klebsiella pneumoniae (n = 86), Enterobacter cloacae (n = 13), Enterobacter aerogenes (n = 6), Proteus mirabilis (n = 7), Citrobacter freundii (n = 13), Morganella morganii (n = 3), Serratia marcescens (n = 5), and Shigella flexneri (n = 1)] clinical isolates were obtained from the First Affiliated Hospital of Zhengzhou University in Central China between September 2015 and March 2016. All strains were confirmed by using Vitek 2 (bioMérieux, France). Antimicrobial susceptibility for the blaCTX-M-55-producing strains and transconjugants were determined using Vitek 2, followed by the measurement of minimum inhibitory concentrations (MICs) utilizing the broth microdilution method (for piperacillin–tazobactam, ampicillin–sulbactam, cefotaxime, ceftazidime, cefotetan, cefepime, imipenem, ertapenem, amikacin, gentamicin, levofloxacin, and ciprofloxacin). Microbroth and agar dilution methods were standardized following the protocols from the Clinical and Laboratory Standards Institute (CLSI) [18]. The MIC results were judged by 2014 CLSI criteria [18]. All isolates were confirmed to have the ESBL phenotype through the CLSI disc confirmatory test [18]. K. pneumoniae ATCC 700603 and E. coli ATCC 25922 were used as quality control strains.

Identification of resistance genes and the genetic contexts of bla CTX-M-55

To verify the emergence of plasmid-mediated ESBL genes, all ESBL-positive strains were further characterized, and plasmid DNA was extracted utilizing a Tiangen Plasmid Purification Mini Kit (Tiangen Biotech, China) referring to the protocol of manufacturer. The primer sequences presented in Table 1 were used for the bla TEM , bla SHV , and blaCTX-M-1-groups to determine the genetic context of blaCTX-M-55. Purified PCR productions were sequenced immediately from two ends and compared with genes in GenBank (http://www.ncbi.nlm.nih.gov/genebank/).
Table 1

PCR primers characteristics in this study

PCR target

Primer name

Primer sequence (5′→3′)

Annealing temperature (°C)

Product (bp)

Reference

Upstream flanking region of blaCTX-M-55

ISEcp1-F

CAAAATGATCCCCTCGTCAAC

55

Variable

[29]

IS26-F

TTACATTTCAAAAACTCTGCTTACC

57

Variable

[32]

blaCTX-M-1-R

ACTTTACTGGTACTGCACAT

   

Downstream flanking region of blaCTX-M-55

blaCTX-M-1-F

TTCTGGTGACRTACTTRACCCA

   

IS903-R

GTTTAATGACCAGCACAGT

55

364

This study

ORF477-R

TCGTTTCGTGGTGCTGAATTT

57

Variable

[29]

bla CTX-M-1

blaCTX-M-1-F

CAGCGCTTTTGCCGTCTAAG

52

946

This study

blaCTX-M-1-R

GGCCCATGGTTAAAAAATCACTGC

bla TEM

bla TEM -F

CATTTCCGTGTCGCCCTTATTC

56

800

[11]

bla TEM -R

CGTTCATCCATAGTTGCCTGAC

bla SHV

bla SHV -F

AGCCGCTTGAGCAAATTAAAC

55

713

[11]

bla SHV -R

ATCCCGCAGATAAATCACCAC

Multilocus sequence typing (MLST)

MLST for clinical E. coli and K. pneumoniae strains were detected basis on the assay discussed above [19, 20]. The sequence types (STs) and allelic profiles were assigned after comparing them to an online database (http://bigsdb.Pasteur.fr/ecoli/ecoli.html and http://bigsdb.Pasteur.fr/klebsiella/klebsiella.html).

Conjugation experiments

Conjugative assays were performed using the methods discussed above [7]. The blaCTX-M-55-positive isolates served as donors, and E. coli C600 functioned as a recipient. Transconjugants were screened on Mueller–Hinton agar containing 750 μg/ml rifampin and 100 μg/ml ampicillin. The existence of blaCTX-M-55 in the transconjugants was identified through antimicrobial susceptibility, PCR and DNA sequencing.

Results

Identification of bla CTX-M-55-positive isolates and their antimicrobial susceptibility and resistance determinants

Based on the results of this study, among 227 ESBL-positive Enterobacteriaceae, 13 [13/227 (5.73%)] were identified as blaCTX-M-55-positive, including 7/93 E. coli, 3/86 K. pneumoniae, 1/13 C. freundii, 1/3 M. morganii, and 1/5 S. marcescens, which were collected from blood (n = 6), urine (n = 3), and sputum (n = 3) samples (Table 2). The antimicrobial susceptibility analyses of the 13 blaCTX-M-55-positive isolates are presented in Table 3. All strains were insusceptible to third-generation cephalosporins (ceftazidime and cefotaxime), fluoroquinolones (levofloxacin and ciprofloxacin), and gentamicin. In addition, 100% susceptibility to amikacin was found. The isolates were also generally sensitive to imipenem (10/13, 76.92%) and ertapenem (9/13, 69.23%), whereas all the other microbiotics, including cefepime, cefotetan and piperacillin–tazobactam, exhibited moderate to low susceptibility. Additionally, among 13 isolates carrying blaCTX-M-55, 5 isolates contained bla TEM , and 2 isolates had both bla TEM and bla SHV (Table 3).
Table 2

Characterisitics of blaCTX-M-55-positive isolates

Isolate

Specimen

Department

ESBL

MLST

EC30

Blood

Urology

TEM/SHV

ST156

EC32

Blood

Gastroenterology

ST305

EC44

Urine

Respiration

ST182

EC45

Sputum

ICU

TEM

ST305

EC52

Blood

Urology

ST381

EC54

Blood

EICU

ST446

EC67

Blood

Gastroenterology

TEM

ST2

KP26

Sputum

Thoracic surgery

TEM

ST148

KP37

Blood

General surgery

TEM/SHV

ST269

KP146

Urine

Urology

TEM

ST37

CF547

Urine

Urology

MM556

Drainage fluid

Anus and intestine surgery

TEM

SM554

Sputum

Neurosurgery

EC, E. coil; KP, K. pneumoniae; CF, C. freundii; MM, M. morganii; SM, S. marcescens; ICU, intensive care unit; EICU, emergency ICU

Table 3

Antibiotic susceptibilities of blaCTX-M-55-positive and their transconjugants

Isolate

Antibiotica susceptibility (μg/ml)

SAM

TZP

CTX

CAZ

CTT

FEP

IPM

ETP

AMK

GEN

LVX

CIP

EC30

> 256

> 256

> 256

> 256

> 256

> 256

< 1

2

< 2

64

> 32

> 32

EC32

> 256

8

> 256

> 256

8

> 256

< 1

1

< 2

64

16

8

EC44

> 256

8

> 256

> 256

8

> 256

< 1

<0.5

< 2

32

16

8

EC45

> 256

64

> 256

> 256

32

> 256

< 1

<0.5

< 2

32

16

8

EC52

> 256

8

> 256

> 256

8

2

< 1

<0.5

< 2

64

> 32

8

EC54

> 256

8

> 256

> 256

8

16

< 1

<0.5

< 2

32

16

8

EC67

> 256

> 256

> 256

> 256

>256

> 256

< 1

2

< 2

32

> 32

8

KP26

> 256

64

> 256

> 256

32

> 256

< 1

1

< 2

32

> 32

8

KP37

> 256

> 256

> 256

> 256

> 256

> 256

8

2

< 2

32

16

8

KP146

> 256

64

> 256

> 256

> 256

> 256

8

2

< 2

64

> 32

8

CF547

> 256

8

> 256

64

8

> 256

< 1

< 0.5

< 2

64

16

8

MM556

> 256

64

> 256

> 256

> 256

2

< 1

< 0.5

< 2

32

16

8

SM554

> 256

8

> 256

64

8

> 256

8

< 0.5

4

32

16

8

E. coil transconjugants

 EC30-C600

> 256

64

> 256

> 256

> 256

> 256

< 1

2

< 2

64

< 0.25

< 0.25

 EC32-C600

> 256

8

> 256

> 256

8

8

< 1

1

< 2

32

< 0.25

< 0.25

 EC44-C600

> 256

8

128

64

4

4

< 1

< 0.5

< 2

32

< 0.25

< 0.25

 EC45-C600

> 256

32

> 256

> 256

32

16

< 1

< 0.5

< 2

16

< 0.25

< 0.25

 EC52-C600

> 256

8

> 256

128

8

2

< 1

< 0.5

< 2

32

< 0.25

< 0.25

 EC54-C600

> 256

8

128

> 256

8

16

< 1

< 0.5

< 2

32

< 0.25

< 0.25

 EC67-C600

> 256

> 256

> 256

128

> 256

> 256

< 1

2

< 2

16

< 0.25

< 0.25

 KP26-C600

> 256

32

> 256

> 256

16

8

< 1

1

< 2

32

< 0.25

< 0.25

 KP37-C600

> 256

64

64

128

> 256

8

8

2

< 2

16

< 0.25

< 0.25

 KP146-C600

> 256

32

> 256

> 256

> 256

> 256

8

2

< 2

64

< 0.25

< 0.25

 CF547-C600

> 256

4

> 256

64

8

32

< 1

< 0.5

< 2

32

< 0.25

< 0.25

 MM556-C600

> 256

64

64

> 256

> 256

2

< 1

< 0.5

< 2

16

< 0.25

< 0.25

 SM554-C600

> 256

8

> 256

64

8

32

8

< 0.5

4

32

< 0.25

< 0.25

 EC-C600

< 2

< 4

< 1

< 1

< 4

< 1

< 1

< 0.5

< 2

< 1

< 0.25

< 0.25

EC, E. coil; KP, K. pneumoniae; CF, C. freundii; MM, M. morganii; SM, S. marcescens

aSAM, ampicillin–sulbactam (1/0.5–256/128) [(μg/ml) for each agent, and the numbers in parentheses indicate the test range]; TZP, piperacillin–tazobactam (0.5/4–256/4); CTX, cefotaxime (0.03–256); CAZ, ceftazidime (0.03–256); CTT, cefotetan (0.03–256); FEP, cefepime (0.015–256); IPM, imipenem (0.06–32); ETP, ertapenem (0.004–32); AMK, amikacin (0.5–256); GEN, gentamicin (0.25–256); LVX, levofloxacin (0.008–32); CIP, ciprofloxacin (0.004–32)

MLST and conjugal transfer of the bla CTX-M-55 gene

MLST was detected for blaCTX-M-55-positive E. coli and K. pneumoniae strains. Nine types of MLST were detected among the 7 E. coli strains (ST156, ST305, ST182, ST381, ST446 and ST2) and 3 K. pneumoniae strains (ST148, ST269 and ST37). Two E. coli isolates (EC32 and EC45) shared the same ST type (ST305) (Table 2). Conjugative assays indicated that all blaCTX-M-55 plasmids were transmitted to E. coli C600 from 13 donors successfully through conjugation. Although all transconjugants exhibited resistance to cefotaxime and ceftazidime, they were all sensitive to fluoroquinolones. Additionally, the bla TEM and bla SHV resistance genes were transformed to E. coli C600 with the blaCTX-M-55 for some isolates (Table 3).

Genetic contexts of bla CTX-M-55

The flanking region of blaCTX-M-55 is presented in Fig. 1. Four different architectures [type I (9 isolates), type II (2 isolates), type III (1 isolate), and type IV (1 isolate)] were identified regarding the genetic contexts of the plasmid-mediated blaCTX-M-55 genes. Type I architecture (ISEcp1∆-blaCTX-M-55-∆ORF477) was the most common and was identified in 9 (69.23%) of 13 blaCTX-M-55-positive isolates; the occurrence of type II (IS26-∆ISEcp1-blaCTX-M-55-∆ORF477) and type III architecture (ISEcp1∆-IS1294-∆ISEcp1-blaCTX-M-55-∆ORF477) was similar to type I architecture, although ISEcp1 was disrupted by IS26 in type II and by IS1294 in type III. Type IV (ISEcp1∆-blaCTX-M-55-∆IS903) was characterized by the existence of IS903, which was detected firstly downstream of blaCTX-M-55.
Fig. 1
Fig. 1

Surrounding the regions of blaCTX-M-55 gene in this study. Type I architecture (ISEcp1∆-blaCTX-M-55-∆ORF477) was found in isolates (EC32, EC44, EC52, EC67, KP26, KP146, CF547, MM556, SM554) (GenBank Accession Numbers: KX889071; KX889081; KX889072; KX889073; KX889074; KX889075; KX889076; KX889077; KX889078); Type II architecture (IS26-∆ISEcp1-blaCTX-M-55-∆ORF477) was found in isolates (EC45, KP37) (GenBank Accession Numbers: KX889079; KX889080); Type III architecture (ISEcp1∆-IS1294-∆ISEcp1-blaCTX-M-55-∆ORF477) was found in isolate (EC30) (GenBank Accession Number: KX889070); Type IV architecture (ISEcp1∆-blaCTX-M-55-∆IS903) was found in isolate (EC54) (GenBank Accession Numbers: KX898438 and KX898439)

Discussion

Since the CTX-M-55 firstly reported in 2006, it has been identified in E. coli, K. pneumoniae, S. flexneri and Salmonella enteritidis [3, 7, 10]. For all we know, blaCTX-M-55 in C. freundii and M. morganii is firstly detected in this study. In addition, 13/227 isolates were identified as blaCTX-M-55-positive in just 7 months. This rate far surpasses other ESBLs [2123], which demonstrates the rapid dissemination of blaCTX-M-55. Notably, all blaCTX-M-55-positive isolates were identified as multiple drug-resistant (MDR) bacteria that are strongly resistant to ceftazidime and cefotaxime (MIC > 256 μg/ml). More significantly, molecular characterization also revealed that most of the blaCTX-M-55-positive isolates harbored bla TEM . In addition, some isolates contained bla SHV . These results imply that the spreading of blaCTX-M-55 over many different genera of Enterobacteriaceae is activated in hospitals in Henan Province, which represents a public health issue due to the inability to treat these bacteria.

Two E. coli isolates (EC32 and EC45) isolated from two different departments (Gastroenterology and ICU) shared the same ST type (ST305), which suggests that they are clonally related. However, the data indicate that the CTX-M-55-positive E. coli and K. pneumoniae strains identified in our study were not clonally related by MLST, which indicates that there is no specific ST in Henan Province. This finding contrasts with observations in the region of European and North American, where a high prevalence of ST131 has been observed [24]. Furthermore, this study demonstrates the association of eight STs [ST305, ST182, ST381, ST446 and ST2 (E. coli) and ST148, ST269 and ST37 (K. pneumoniae)] with the products of CTX-M-55 first time, which means blaCTX-M-55 has been actively spreading among Enterobacteriaceae in China. Given our focus on conjugative assays, the 13 transconjugants all exhibited resistance to cefotaxime and ceftazidime but sensitivity to fluoroquinolones, which was consistent with the original isolates. These results suggest that the plasmid-mediated blaCTX-M-55-gene is to answer for an ESBL phenotype with poor susceptibility to cefotaxime and ceftazidime and exhibits a strong transferability of resistance. This finding also indicates that fluoroquinolones should be used for the therapy of blaCTX-M-55-positive pathogen infections in clinical settings. Interestingly, our data indicate that some original isolates were resistant to cefepime, but the transconjugants were susceptible, which suggests that the original isolates may include other resistance genes that promote resistance to cefepime. We did not detect these genes in our study. These resistance genes cannot be transmitted through conjugative assays and are not located on the chromosome. Thus, this mechanism requires further study.

The sporadic existence of CTX-M-55-positive strains in mainland China has been occasionally detected. In some surveys, CTX-M-55 incidence has surpassed that of CTX-M-15 [25]. Heterogeneous genetic contexts may indicate the dissemination and mobilization of blaCTX-M-55. As shown in Fig. 1, all isolates were detected ISEcp1, locating upstream of blaCTX-M-55; this region contain the promoter sequence (− 35 and − 10) and act as a significant role in the expression and mobilization of the β-lactamase genes [12, 15, 26]. Moreover, the presence of ISEcp1 in this cross-species study indicates that the complete or partial insertion sequence was probably excised along with CTX-M-55 during horizontal transfer. Previous reports demonstrated that the disruption of the ISEcp1 element by IS26 was linked to the promotion of bla CTX gene dissemination [27, 28]. Interestingly, as previously reported, ISEcp1 disruption by IS1294 in blaCTX-M-55 was detected from a chicken in China, which may contribute to the mobilization of blaCTX-M-55 [29]. Remarkably, the two E. coli strains [EC30 (this study) and E. coli C21 [29] ] shared the same MLST type (ST156), which suggests that these isolates are clonally related. This coincidence implies that blaCTX-M-55 is likely to be transferred from animals to the clinical setting. Fey et al. found that a 12-year-old boy acquired ceftriaxone-resistant Salmonella enterica serotype Typhimurium from cattle [30]. Jing Zhang et al. reported that CTX-M-55 had already been transmitted to humankind from animals and is distributed among both hospitals and community in China. The findings of our investigation and previous studies indicate that blaCTX-M-55 can be transmitted to humankind from food and can enhance clinical resistance. Notably, the novel arrangement ISEcp1∆-blaCTX-M-55-∆IS903 is characterized by the element of IS903 which is detected downstream of blaCTX-M-55 first time and often identified by the context of other blaCTX-M genes [31]. The mechanism responsible for its presence remains unclear. According to Poirel et al., ISEcp1, bla CTX and IS903 form a putative transposon, and this block of genes could be disseminated by transposition [26, 32]. This finding implies that IS903 contributes to the dissemination of blaCTX-M-55, which requires further study. Therefore, our findings strongly suggest that genetic elements (ISEcp1, ORF477, IS26, IS1294, and IS903) are involved in the inter-species and intra-species mobilization and dissemination of blaCTX-M-55. Additionally, CTX-M-55-harboring isolates in animals may act as a potential storage of bacterial that is spread in clinical.

Conclusions

This investigation reminds a high occurrence rate of CTX-M-55-producing ESBLs in patients from different departments at the First Affiliated Hospital of Zhengzhou University in Henan Province. These plasmid-mediated blaCTX-M-55-positive isolates are contributed to the transmission of blaCTX-M-55 to new species and new hosts by conjugation. Data obtained in this study suggest that the genetic context of blaCTX-M-55, especially ISEcp1, act as a vital part in the mobilization, dissemination and expression of drug resistance determinants. We also demonstrated a novel arrangement of blaCTX-M-55 (ISEcp1∆-blaCTX-M-55-∆IS903). Thus, the presence of MDR Enterobacteriaceae contains conjugative plasmids that co-harbor other IS elements, such as ISEcp1, should be surveilled worldwide because the active transfer and high prevalence of these pathogenic will significantly decrease our further selection of clinical therapies. Further studies on this issue should be performed to help us obtain a deeper understanding of the transmission and dissemination of plasmid-mediated blaCTX-M-55 in different genetic platforms.

Nucleotide sequence accession number

The nucleotide sequences presence in this study have been submitted to GenBank under the following accession numbers: KX889070 (E. coli: EC30); KX889071 (E. coli: EC32); KX889072 (E. coli: EC52); KX898438 and KX898439 (E. coli: EC54); KX889073 (E. coli: EC67); KX889074 (K. pneumoniae: KP26); KX889075 (K. pneumoniae: KP146); KX889076 (C. freundii: CF547); KX889077 (M. morganii: MM556); KX889078 (S. marcescens: SM554); KX889079 (E. coli: EC45); KX889080 (K. pneumoniae: KP37); KX889081 (E. coli: EC44).

Notes

Declarations

Authors’ contributions

JG and XH contributed to study design. XH, YR and YL collected the samples and performed the experiments. All authors contributed to data analysis. JG and XH drafted the manuscript. All authors read and approved the final manuscript.

Acknowledgements

The authors acknowledge members of the clinical microbiology laboratory for providing resistance profiles and their help with phenotype tests.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Funding

This study was sponsored by Grant No. 201403044 from the Project of Medical Science and Technology Program of Henan Province and Grant No. 162102310509 from Henan Science and Technology Department.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Clinical Laboratory, First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan, China
(2)
Key Laboratory of Laboratory Medicine of Henan Province, Zhengzhou, Henan, China
(3)
School of Medicine, Pusan National University, Busan, Republic of Korea
(4)
Department of Medical Laboratory Technology, Xinyang Vocational and Technical College, Xinyang, Henan, China

References

  1. Bauernfeind A, Grimm H, Schweighart S. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli. Infection. 1990;18(5):294–8. https://doi.org/10.1007/BF01647010.View ArticlePubMedGoogle Scholar
  2. Canton R, Coque TM. The CTX-M beta-lactamase pandemic. Curr Opin Microbiol. 2006;9(5):466–75. https://doi.org/10.1016/j.mib.2006.08.011.View ArticlePubMedGoogle Scholar
  3. Kiratisin P, Apisarnthanarak A, Saifon P, Laesripa C, Kitphati R, Mundy LM. The emergence of a novel ceftazidime-resistant CTX-M extended-spectrum beta-lactamase, CTX-M-55, in both community-onset and hospital-acquired infections in Thailand. Diagn Microbiol Infect Dis. 2007;58(3):349–55. https://doi.org/10.1016/j.diagmicrobio.2007.02.005.View ArticlePubMedGoogle Scholar
  4. Apisarnthanarak A, Kiratisin P, Saifon P. Risk factors and outcomes of community associated extended spectrum beta-lactamase producing Escherichia coli and Klebsiella pneumoniae in a tertiary care center in Thailand. In: Program and abstract of the 16th annual meeting of society for healthcare epidemiology of North America (SHEA), Chicago, IL. Chicago, IL; 2006.Google Scholar
  5. Hopkins KL, Threlfall EJ, Karisik E, Wardle JK. Identification of novel plasmid-mediated extended-spectrum beta-lactamase CTX-M-57 in Salmonella enterica serovar Typhimurium. Int J Antimicrob Agents. 2008;31(1):85–6. https://doi.org/10.1016/j.ijantimicag.2007.08.017.View ArticlePubMedGoogle Scholar
  6. Lee W, Chung HS, Lee H, Yum JH, Yong D, Jeong SH, Lee K, Chong Y. CTX-M-55-type extended-spectrum beta-lactamase-producing Shigella sonnei isolated from a Korean patient who had travelled to China. Ann Lab Med. 2013;33(2):141–4. https://doi.org/10.3343/alm.2013.33.2.141.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Qu F, Ying Z, Zhang C, Chen Z, Chen S, Cui E, Bao C, Yang H, Wang J, Liu C, et al. Genetic characterization of IncI2 plasmids carrying blaCTX-M-55 spreading in both pets and food animals in China. Fut Microbiol. 2014;10(9):1143–50. https://doi.org/10.1128/AAC.02155-12.View ArticleGoogle Scholar
  8. Wang L, Fang H, Feng J, Yin Z, Xie X, Zhu X, Wang J, Chen W, Yang R, Du H, et al. Complete sequences of KPC-2-encoding plasmid p628-KPC and CTX-M-55-encoding p628-CTXM coexisted in Klebsiella pneumoniae. Front Microbiol. 2015;6:838. https://doi.org/10.3389/fmicb.2015.00838 (eCollection 2015).PubMedPubMed CentralGoogle Scholar
  9. Wang S, Zhao SY, Xiao SZ, Gu FF, Liu QZ, Tang J, Guo XK, Ni YX, Han LZ. Antimicrobial resistance and molecular epidemiology of Escherichia coli causing bloodstream infections in three hospitals in Shanghai, China. PLoS ONE. 2016;11(1):e0147740. https://doi.org/10.1371/journal.pone.0147740.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Imoto A, Ooi Y, Edogawa S, Ogura T, Masuda D, Mohamed M, Takii M, Umegaki E, Kawahara R, Ukimura A, et al. Liver abscess caused by CTX-M-55-type extended-spectrum beta-lactamase (ESBL)-producing Salmonella enteritidis. Intern Med. 2014;53(15):1699–703. https://doi.org/10.2169/internalmedicine.53.2407.View ArticlePubMedGoogle Scholar
  11. Guo X, Cao Z, Dai Z, Li Y, He X, Hu X, Tian F, Ren Y. Antimicrobial susceptibility and molecular epidemiology of multidrug-resistant Klebsiella pneumoniae in Central China. Jpn J Infect Dis. 2016. https://doi.org/10.7883/yoken.JJID.2016.049.PubMedGoogle Scholar
  12. Karim A, Poirel L, Nagarajan S, Nordmann P. Plasmid-mediated extended-spectrum beta-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol Lett. 2001;201(2):237–41. https://doi.org/10.1111/j.1574-6968.2001.tb10762.x.PubMedGoogle Scholar
  13. Mahillon J, Chandler M. Insertion sequences. Microbiol Mol Biol Rev. 1998;62(3):725–74.PubMedPubMed CentralGoogle Scholar
  14. Poirel L, Decousser JW, Nordmann P. Insertion sequence ISEcp1B is involved in expression and mobilization of a blaCTX-M-lactamase gene. Antimicrob Agents Chemother. 2003;47(9):2938–45. https://doi.org/10.1128/aac.47.9.2938-2945.2003.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Wang Y, Song C, Duan G, Zhu J, Yang H, Xi Y, Fan Q. Transposition of ISEcp1 modulates blaCTX-M-55-mediated Shigella flexneri resistance to cefalothin. Int J Antimicrob Agents. 2013;42(6):507–12. https://doi.org/10.1016/j.ijantimicag.2013.08.009.View ArticlePubMedGoogle Scholar
  16. Poirel L, Naas T, Nordmann P. Genetic support of extended-spectrum beta-lactamases. Clin Microbiol Infect. 2008;14(Suppl 1):75–81. https://doi.org/10.1111/j.1469-0691.2007.01865.x.View ArticlePubMedGoogle Scholar
  17. Lartigue MF, Poirel L, Nordmann P. Diversity of genetic environment of bla(CTX-M) genes. FEMS Microbiol Lett. 2004;234(2):201–7. https://doi.org/10.1016/j.femsle.2004.01.051.View ArticlePubMedGoogle Scholar
  18. Institute CaLS. Performance standards for antimicrobial susceptibility testing; 24th informational supplement, M100-S24. Wayne: Institute CaLS; 2014.Google Scholar
  19. Wirth T, Falush D, Lan R, Colles F, Mensa P, Wieler LH, Karch H, Reeves PR, Maiden MC, Ochman H, et al. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006;60(5):1136–51. https://doi.org/10.1111/j.1365-2958.2006.05172.x.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol. 2005;43(8):4178–82. https://doi.org/10.1128/JCM.43.8.4178-4182.2005.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Robin F, Beyrouthy R, Bonacorsi S, Aissa N, Bret L, Brieu N, Cattoir V, Chapuis A, Chardon H, Degand N, et al. Inventory of extended-spectrum-beta-lactamase-producing Enterobacteriaceae in France as assessed by a multicenter study. Antimicrob Agents Chemother. 2017;61(3):e01911–6. https://doi.org/10.1128/aac.01911-16.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Oduro-Mensah D, Obeng-Nkrumah N, Bonney EY, Oduro-Mensah E, Twum-Danso K, Osei YD, Sackey ST. Genetic characterization of TEM-type ESBL-associated antibacterial resistance in Enterobacteriaceae in a tertiary hospital in Ghana. Ann Clin Microbiol Antimicrob. 2016;15:29. https://doi.org/10.1186/s12941-016-0144-2.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Rameshkumar G, Ramakrishnan R, Shivkumar C, Meenakshi R, Anitha V, Venugopal Reddy YC, Maneksha V. Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections. Indian J Ophthalmol. 2016;64(4):303–11. https://doi.org/10.4103/0301-4738.182943.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Rogers BA, Sidjabat HE, Paterson DL. Escherichia coli O25b-ST131: a pandemic, multiresistant, community-associated strain. J Antimicrob Chemother. 2011;66(1):1–14. https://doi.org/10.1093/jac/q415.View ArticlePubMedGoogle Scholar
  25. Zhang J, Zheng B, Zhao L, Wei Z, Ji J, Li L, Xiao Y. Nationwide high prevalence of CTX-M and an increase of CTX-M-55 in Escherichia coli isolated from patients with community-onset infections in Chinese county hospitals. BMC Infect Dis. 2014;14:659. https://doi.org/10.1186/s12879-014-0659-0.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Poirel L, Lartigue MF, Decousser JW, Nordmann P. ISEcp1B-mediated transposition of blaCTX-M in Escherichia coli. Antimicrob Agents Chemother. 2005;49(1):447–50. https://doi.org/10.1128/AAC.49.1.447-450.2005.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Ensor VM, Shahid M, Evans JT, Hawkey PM. Occurrence, prevalence and genetic environment of CTX-M beta-lactamases in Enterobacteriaceae from Indian hospitals. J Antimicrob Chemother. 2006;58(6):1260–3. https://doi.org/10.1093/jac/l422.View ArticlePubMedGoogle Scholar
  28. Cullik A, Pfeifer Y, Prager R, von Baum H, Witte W. A novel IS26 structure surrounds blaCTX-M genes in different plasmids from German clinical Escherichia coli isolates. J Med Microbiol. 2010;59(Pt 5):580–7. https://doi.org/10.1099/jmm.0.016188-0.View ArticlePubMedGoogle Scholar
  29. Pan YS, Liu JH, Hu H, Zhao JF, Yuan L, Wu H, Wang LF, Hu GZ. Novel arrangement of the blaCTX-M-55 gene in an Escherichia coli isolate coproducing 16S rRNA methylase. J Basic Microbiol. 2013;53(11):928–33. https://doi.org/10.1002/jobm.201200318.View ArticlePubMedGoogle Scholar
  30. Fey PD, Safranek TJ, Rupp ME, Dunne EF, Ribot E, Iwen PC, Bradford PA, Angulo FJ, Hinrichs SH. Ceftriaxone-resistant salmonella infection acquired by a child from cattle. N Engl J Med. 2000;342(17):1242–9. https://doi.org/10.1056/NEJM200004273421703.View ArticlePubMedGoogle Scholar
  31. Zhao WH, Hu ZQ. Epidemiology and genetics of CTX-M extended-spectrum beta-lactamases in Gram-negative bacteria. Crit Rev Microbiol. 2013;39(1):79–101. https://doi.org/10.3109/1040841X.2012.691460.View ArticlePubMedGoogle Scholar
  32. Dhanji H, Doumith M, Hope R, Livermore DM, Woodford N. ISEcp1-mediated transposition of linked blaCTX-M-3 and blaTEM-1b from the IncI1 plasmid pEK204 found in clinical isolates of Escherichia coli from Belfast, UK. J Antimicrob Chemother. 2011;66(10):2263–5. https://doi.org/10.1093/jac/r310.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2018

Advertisement