Open Access

Molecular characterization of Staphylococcus aureus isolates from various healthcare institutions in Nairobi, Kenya: a cross sectional study

  • Geoffrey Omuse1Email author,
  • Kristien Nel Van Zyl2,
  • Kim Hoek2,
  • Shima Abdulgader3,
  • Samuel Kariuki4,
  • Andrew Whitelaw2 and
  • Gunturu Revathi1
Annals of Clinical Microbiology and Antimicrobials201615:51

https://doi.org/10.1186/s12941-016-0171-z

Received: 10 August 2016

Accepted: 13 September 2016

Published: 20 September 2016

Abstract

Background

Staphylococcus aureus (S. aureus) has established itself over the years as a major cause of morbidity and mortality both within the community and in healthcare settings. Methicillin resistant S. aureus (MRSA) in particular has been a major cause of nosocomial infections resulting in significant increase in healthcare costs. In Africa, the MRSA prevalence has been shown to vary across different countries. In order to better understand the epidemiology of MRSA in a setting, it is important to define its population structure using molecular tools as different clones have been found to predominate in certain geographical locations.

Methods

We carried out PFGE, MLST, SCCmec and spa typing of selected S. aureus isolates from a private and public referral hospital in Nairobi, Kenya.

Results

A total of 93 S. aureus isolates were grouped into 19 PFGE clonal complexes (A–S) and 12 singletons. From these, 55 (32 MRSA and 23 MSSA) representative isolates from each PFGE clonal complex and all singletons were spa typed. There were 18 different MRSA spa types and 22 MSSA spa types. The predominant MRSA spa type was t037 comprising 40.6 % (13/32) of all MRSA. In contrast, the MSSA were quite heterogeneous, only 2 out of 23 MSSA shared the same spa type. Two new MRSA spa types (t13149 and t13150) and 3 new MSSA spa types (t13182, t13193 and t13194) were identified. The predominant clonal complex was CC 5 which included multi-locus sequence types 1, 8 and 241.

Conclusion

In contrast to previous studies published from Kenya, there’s marked genetic diversity amongst clinical MRSA isolates in Nairobi including the presence of well-known epidemic MRSA clones. Given that these clones are resident within our referral hospitals, adherence to strict infection control measures needs to be ensured to reduce morbidity and mortality associated with hospital acquired MRSA infections.

Keywords

Staphylococcus aureus MRSAMSSAKenya

Background

Staphylococcus aureus (S. aureus) has established itself over the years as a major cause of morbidity and mortality globally both within the community and in healthcare settings [13]. Its ability to cause disease is aided not only by its impressive repertoire of virulence factors but also its ability to develop resistance to antibiotics used in its treatment epitomized by the emergence of methicillin resistant S. aureus (MRSA). Methicillin resistance is conferred by the mecA gene that is carried on a staphylococcal cassette chromosome mec (SCCmec) and codes for a modified penicillin binding protein (PBP2a). This binding protein has reduced affinity to all beta-lactam and beta-lactam/beta-lactamase inhibitor combination antibiotics [4, 5]. In Africa, the MRSA prevalence has been shown to vary across different countries with a prevalence as low as 7 % reported in Madagascar and as high as 82 % in Egypt [6]. This marked variation could be due to different environmental determinants or simply due to a difference in the genetic diversity of S. aureus. In Kenya, there is a marked difference in reported MRSA prevalence in clinical isolates within Nairobi with one recent study reporting a prevalence of 3.7 % while another reported 87.2 % [7, 8]. In order to better understand the epidemiology of MRSA, it is important to define its population structure. Molecular characterization helps in identifying clonal populations which can help in surveillance and investigation of outbreaks.

There is a growing interest in the characterization of MRSA isolates and this stems primarily from its role as a major cause of hospital and community acquired infections [1, 9, 10]. There are various molecular methods used, the more common ones include multi-locus sequence typing (MLST), pulse field gel electrophoresis (PFGE), staphylococcal protein A (spa) typing and SCCmec typing [11]. Despite S. aureus having a very diverse clonal population, MLST studies have shown that a small set of clonal complexes (CC) are associated with most of the MRSA epidemics. These include CC5, CC22, CC30, CC45 and CC80 [6, 12, 13]. A clonal complex can have several sequence types, however the multi-locus sequence types that are regarded as the founders in these clonal complexes are ST5, ST22, ST30, ST45 and ST80 respectively [14]. As regards spa types, it has been shown that particular ones are more predominant in certain regions. For example t030 is quite predominant in hospitals in Turkey [15], t042 and t044 are more common in North Africa while t008 is common in the US [16]. Unfortunately, the molecular epidemiology of MRSA in Africa is not very well described. Most of the studies carried out in Africa characterizing MRSA have emanated from a few countries namely Tunisia, Nigeria, South Africa, Algeria and Egypt [6]. There are very few studies from East Africa that have reported on the molecular characterization of S. aureus presumably due to lack of readily available technical expertise and laboratory facilities. A study done in Kenya looking at carriage of S. aureus by inpatients in a government hospital found that only 6 out of 86 (7 %) S. aureus isolates were MRSA and they all belonged to the same clone (MLST ST239; spa type t037) [17]. This clone is a globally distributed hybrid of ST8 and ST30 and is known to be responsible for several outbreaks in different continents [1821]. The only other study from Kenya did not report on spa or multi locus sequence types [8].

We set out to characterize selected S. aureus isolates from different hospitals in Nairobi, Kenya in order to identify which clonal lineages are present and further shed light on the molecular epidemiology of both MSSA and MRSA in Kenya.

Methods

We obtained archived methicillin susceptible (MSSA) and MRSA isolates from 2 hospitals in Nairobi, Kenya collected between January 2010 and July 2013. The hospitals included a government hospital whose samples we obtained through the Kenya Medical Research Institute (KEMRI) and the Aga Khan University Hospital Nairobi (AKUHN) which is a private referral hospital with a network of satellite clinics and laboratories spread in and around Nairobi as well as different parts of the country. The isolates from the government hospital were part of a previous study done to determine prevalence of MRSA carriage in a paediatric ward and the rest of the isolates were from clinical specimens submitted to the AKUHN laboratory for routine culture and sensitivity. These were convenience isolates that were not collected through a well-structured, formal and documented process. All isolates were stored at −80 °C and grown overnight on sheep blood agar plates at 37 °C.

S. aureus identification

All isolates were confirmed to be S. aureus using routine bench identification methods which included growth characteristics on sheep blood agar, gram stain, catalase, coagulase, deoxyribonuclease (DNase) and mannitol fermentation tests. A cefoxitin screen using a 30 µg disc (Oxoid, United Kingdom) was performed to distinguish MSSA from MRSA. Isolates with a diameter ≤21 mm were classified as MRSA.

Antibiotic susceptibility

Antibiotic susceptibility was only available for the MRSA isolates obtained from AKUHN. These were performed on Vitek 2 (version 4.01, bioMerieux, Marcy-l’Etoile, France) an automated bacterial identification system that performs antibiotic susceptibility using broth dilution and interpretation based on Clinical Laboratory Standards Institute (CLSI) antimicrobial susceptibility guidelines [22]. Multidrug resistance (MDR) was defined as resistance to three or more drug classes.

DNA derivation

Isolates were grown on blood agar plates (National Health Laboratory Services Media Lab, Cape Town, South Africa) at 37 °C overnight. After incubation, 4–5 large colonies were re-suspended in 200 µL nuclease free water. The samples were incubated at 95 °C for 30 min, followed by −80 °C for 30 min and centrifuged for 10 min at 14,000×g when thawed. The supernatant containing DNA was carefully aspirated without disturbing the pellet of cell debris and stored as DNA aliquots at −20° C until further use.

PFGE

PFGE based on SmaI macrorestriction analysis was performed using the CDC laboratory protocol for S. aureus [23]. The PFGE was run on a CHEF DR III system (Bio-Rad, California, United States of America) with optimum settings as follows: initial 5 s, switch 30 s, run time 29 h, voltage 6 V/cm and a SeaKem Gold agarose (Lonza, Rockland, USA) gel concentration of 1.4 %. S. aureus NCTC 8325 was used as a control in each gel run. Gels were visualized an Alliance 2.7 (UVItec, Cambridge, United Kingdom) gel documentation system after staining with 10 mg/mL ethidium bromide. Analysis of PFGE clusters was performed using the BioNumerics software package (Applied Maths, Sint-Martens-Latem, Belgium), using the Dice coefficient, and visualized as a dendrogram by the unweighted-pair group method, using average linkages with 1 % tolerance and 1 % optimization settings. In order to define a cluster, a cutoff of 80 % similarity was used.

SCCmec typing

SCCmec typing was performed using multiplex PCR as described by Milheirico et al. [24]. All assays were performed in a GeneAmp 9600 thermocycler (Applied Biosystems). The optimal cycling conditions were the following: 95 °C for 5 min; 35 cycles of 95 °C for 45 s, 57 °C for 45 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. Each PCR mixture contained 0.5 µL of the primers listed in Table 1, KAPA2G Robust HotStart ReadyMix PCR (KAPA biosystems) which contains KAPA2G Robust HotStart DNA Polymerase (1 U/25 µL reaction) in a proprietary reaction buffer containing dNTPs (0.2 mM of each dNTP at 1X), MgCl2 (2 mM at 1X), 0.3 µL (3 mM) additional MgCl2, 10.7 µL of PCR grade water and genomic DNA in a final volume of 25 µL. The following S. aureus isolates were used as controls: BAA-38, BAA-1681, BAA-39, BAA-1680, BAA-1688 and BAA-42 for SCCmec types I–VI respectively. The PCR products were resolved in a 1 % SeaKem Gold Agarose (Lonza, Rockland, USA) gel in 0.5 % Tris–borate-ethylene-diamine-tetra-acetic acid (EDTA) buffer (Bio-Rad, Hercules, CA) at 4 V/cm for 2.5 h and were visualized with ethidium bromide.
Table 1

Primers used in the updated version of SCCmec multiplex PCR

Primer name

Primer sequence (5 33)

Primer specificity (SCCmec type, region)

Amplicon size (bp)

Conc. (µM)

CIF2 F2

TTCGAGTTGCTGATGAAGAAGG

I, J1 region

495

0.4

CIF2 R2

ATTTACCACAAGGACTACCAGC

  

0.4

ccrC F2

GTACTCGTTACAATGTTTGG

V, ccr complex

449

0.8

ccrC R2

ATAATGGCTTCATGCTTACC

  

0.8

RIF5 F10

TTCTTAAGTACACGCTGAATCG

III, J3 region

414

0.4

RIF5 R13

ATGGAGATGAATTACAAGGG

  

0.4

SCCmec V J1 F

TTCTCCATTCTTGTTCATCC

V, J1 region

377

0.4

SCCmec V J1 R

AGAGACTACTGACTTAAGTGG

  

0.4

dcs F2

CATCCTATGATAGCTTGGTC

I, II, IV, and VI, J3 region

342

0.8

dcs R1

CTAAATCATAGCCATGACCG

  

0.8

ccrB2 F2

AGTTTCTCAGAATTCGAACG

II and IV, ccr complex

311

0.8

ccrB2 R2

CCGATATAGAAWGGGTTAGC

  

0.8

kdp F1

AATCATCTGCCATTGGTGATGC

II, J1 region

284

0.2

kdp R1

CGAATGAAGTGAAAGAAAGTGG

  

0.2

SCCmec III J1 F

CATTTGTGAAACACAGTACG

III, J1 region

243

0.4

SCCmec III J1 R

GTTATTGAGACTCCTAAAGC

  

0.4

mecI P2

ATCAAGACTTGCATTCAGGC

II and III, mec complex

209

0.8

mecI P3

GCGGTTTCAATTCACTTGTC

  

0.8

mecA P4

TCCAGATTACAACTTCACCAGG

Internal positive control

162

0.8

mecA P7

CCACTTCATATCTTGTAACG

  

0.8

spa typing

This was done using the following primers: 1095 F: 5′-AGACGATCCTTCGGTGAGC-3′ and 1517R: 5′-GCTTTTGCAATGTCATTTACTG-3′. PCR reactions consisted of 12.5 uL of KAPA2G Robust HotStart ReadyMix PCR (KAPA biosystems) which contains KAPA2G Robust HotStart DNA Polymerase (1 U per 25 µL reaction) in a proprietary reaction buffer containing dNTPs (0.2 mM of each dNTP at 1X), MgCl2 (2 mM at 1X), 0.5 μM of primers and genomic DNA in a final volume of 25 µL. PCR conditions were 95 °C for 6 min; 30 cycles each of 95 °C for 45 s, 64 °C for 45 s, and 72 °C for 60 s; and a final extension at 72 °C for 6 min. Sequencing was outsourced to inqaba biotec, a biotechnology company based in Pretoria, South Africa. Using the Ridom spa server (http://www.spa.server.ridom.de), spa sequences were automatically assigned to spa types. Sequence types and clonal complexes (spa-CC) were assigned where possible using Based Upon Repeat Patterns (BURP) grouping analysis from the Ridom StaphType software (version 1.4; Ridom GmbH, Würzburg, Germany). For BURP analysis, default parameters were used which allows spa types with maximum 4 genetic differences to be grouped into one cluster resulting in a calculated cost between members of a group being less than or equal to 4.

MLST

MLST was done on representative isolates from each PFGE clonal complex and selected singletons according to the protocol published by Enright et al. [25]. The PCRs were carried out as uniplex reactions consisting of 1 µM of the forward and reverse primers, 12.5 µL of 2× KAPA Taq ReadyMix (KAPA Biosystems), 2.5 mM MgCl2, 1 µL of template DNA and nuclease free water up to 25 µL. The PCR conditions were 95 °C for 5 min, followed by 30 cycles of 95 °C for 45 s, 56 °C for 45 s and 72 °C for 1 min. A final elongation step was carried out at 72 °C for 10 min. 5 µL of the PCR product was visualised with gel electrophoresis at 120 V for 1 h. Sequencing was performed on the remainder of the PCR product by Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa). Sequences were inspected and trimmed in BioEdit Sequence Alignment Editor using reference sequences for each of the seven loci. A consensus sequence was generated from the forward and reverse sequences and used to generate sequence types (STs) on the S. aureus MLST database (http://www.saureus.beta.mlst.net/#). Isolates that were not typed by MLST were assigned STs using BURP analysis. Isolates with the same PFGE clonal complex and spa type were assigned the same STs. MLST clonal complexes (MLST-CC) were determined using a Java applet found at http://www.eburst.mlst.net that uses the eBURST algorithm. The default setting was used in which STs that share identical alleles at 6 or 7 of MLST loci are put in the same group. Where there was a discrepancy between the CC determined using eBURST and BURP, we considered the MLST-CC as the correct one.

Results

A total of 93 S. aureus isolates underwent PFGE. These were subsequently grouped into 19 PFGE clonal complexes (A–S) and 12 singletons. From these, 55 (32 MRSA and 23 MSSA) representative isolates from each PFGE clonal complex and all singletons were spa typed. This comprised 41 isolates from AKUHN and 14 from KEMRI. In total, there were 18 different MRSA spa types and 22 different spa types amongst the MSSA. The predominant MRSA spa type was t037 comprising 40.6 % (13/32) of all MRSA. In contrast, the MSSA were quite heterogeneous, only 2 out of 23 MSSA shared the same spa type. Two new MRSA spa types (t13149 and t13150) and 3 new MSSA spa types (t13182, t13193, t13194) were identified as shown in Table 2. Three spa types (t005, t318 and t1476) were found in both MSSA and MRSA. BURP analysis for both MSSA and MRSA revealed 7 spa-clonal complexes and 14 singletons as shown in Fig. 1. The predominant spa-CC was spa-CC005 which included the new MRSA spa type 13149. SCCmec type-III [3A] was the predominant type followed by SCCmec-IV [2B]. Only one MRSA isolate was non-typeable using the SCCmec protocol published by Milheirico et al. [24]
Table 2

Molecular characterization of methicillin susceptible and resistant Staphylococcus aureus

Isolate No.

Hospital

Sample

ID

spa type

spa-CC

SCCmec type

MLST/spa ST

MLST CC

PFGE CC

PFGE pulsotype

36

AKUHN

Pus swab

MSSA

t645

sng

 

1841a

121

A

A2

84

AKUHN

Pus swab

MSSA

t314

sng

 

121a

121

B

B2

78

AKUHN

Pus swab

MSSA

t355

sng

 

152a

152

C

C1

48

AKUHN

Pus swab

MSSA

t355

sng

 

152b

152

C

C4

91

AKUHN

Nasal swab

MRSA

t005

5

IV

22a

22

D

D2

28

AKUHN

Nasal swab

MRSA

t005

5

IV

22b

22

D

D3

83

AKUHN

Sputum

MRSA

t005

5

IV

22b

22

D

D3

89

AKUHN

Pus swab

MRSA

t13149d

5

IV

NDc

 

D

D1

22

KEMRI

Nasal swab

MRSA

t022

5

IV

22a

22

E

E2

75

AKUHN

Blood

MRSA

t9622

sng

IV

NDc

 

E

E1

15

AKUHN

Pus swab

MSSA

t005

5

 

22a

22

F

F6

12

AKUHN

Pus swab

MSSA

t223

5

 

22a

22

G

G2

71

AKUHN

Pus swab

MSSA

t122

sng

 

30a

30

H

H1

88

AKUHN

Tracheal aspirate

MSSA

t318

sng

 

30a

30

I

I5

16

AKUHN

Pus swab

MSSA

t021

21

 

30a

30

I

I7

23

AKUHN

Sputum

MRSA

t1339

3202/186

UT

88a

88

J

J2

49

KEMRI

Nasal swab

MRSA

t3202

3202/186

UT

NDc

 

J

J1

19

AKUHN

Axillary swab

MSSA

t3841

sng

 

672a

672

K

K2

6

AKUHN

Nasal swab

MRSA

t091

NF3

V

789a

7

L

L2

69

AKUHN

Pus swab

MSSA

t2505

NF3

 

789a

7

L

L1

14

AKUHN

Tracheal aspirate

MSSA

t002

sng

 

5a

5

M

M3

79

AKUHN

Pus swab

MRSA

t13150d

sng

II

5a

5

M

M2

52

AKUHN

Blood

MSSA

t2473

sng

 

72a

72

N

N3

92

AKUHN

Blood

MSSA

t13193d

5

 

22a

22

O

O1

87

AKUHN

Blood

MSSA

t127

sng

 

1a

5

P

P3

81

AKUHN

Ear swab

MRSA

t1476

NF2

V

8a

5

Q

Q1

45

AKUHN

Pus swab

MSSA

t1476

NF2

 

8a

5

Q

Q2

31

AKUHN

Pus swab

MSSA

t064

sng

 

8a

5

R

R4

33

KEMRI

Nasal swab

MRSA

t104

NF1

IV

8a

5

R

R2

7

KEMRI

Nasal swab

MRSA

t689

NF1

I

NDc

 

R

R1

25

AKUHN

Blood

MRSA

t852

5

IV

NDc

 

R

R5

4

AKUHN

Sputum

MRSA

t037

NF4

III

241a

5

S

S1

2

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S10

3

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S10

1

AKUHN

Blood

MRSA

t037

NF4

III

241b

5

S

S11

47

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S2

38

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S3

34

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S4

20

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S5

18

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S6

37

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S7

27

KEMRI

Nasal swab

MRSA

t037

NF4

III

241b

5

S

S9

29

AKUHN

Pus swab

MRSA

t2029

NF4

IV

241a

5

S

S8

13

AKUHN

Pus swab

MRSA

t037

NF4

III

239/240/241c

  

Sng12

11

AKUHN

Pus swab

MRSA

t037

NF4

III

239/240/241c

  

Sng6

17

AKUHN

Pus swab

MSSA

t13182d

sng

 

NDc

  

Sng 3

44

AKUHN

Urine

MSSA

t13194d

sng

 

NDc

  

Sng7

73

AKUHN

Pus swab

MSSA

t1839

345

 

NDc

  

Sng5

58

AKUHN

Blood

MSSA

t186

3202/186

 

88c

  

Sng4

70

AKUHN

Blood

MSSA

t224

345

 

97c

  

Sng8

21

AKUHN

Pus swab

MRSA

t293

sng

IV

NDc

  

Sng 2

43

KEMRI

NASAL SWAB

MRSA

t318

sng

IV

30c

  

Sng 1

35

AKUHN

Pus swab

MRSA

t345

345

V

NDc

  

Sng10

40

AKUHN

Urine

MRSA

t648

NF2

IV

NDc

  

Sng11

85

AKUHN

Vulval swab

MSSA

t131

345

 

NDc

  

Sng9

sng singleton, NF no founder, UT untypeable, ND not defined on the Ridom database Accessed on 07/10/2015

aMLST ST

bMLST ST extrapolated based on similar spa type and pulsotype

c spa ST

dNew spa type

Fig. 1

Based upon repeat pattern clustering analysis for all identified S. aureus isolates: the clustering analysis resulted in seven spa-clonal complexes and 14 singletons. The blue circle represents the group founder and the circle size is proportional to the frequency of the spa type

MLST STs were determined and extrapolated for 31 isolates. A total of seven different MRSA and MSSA MLST-CC were identified with the predominant one being MLST-CC 5. This clonal complex comprised STs 1, 5, 8 and 241 as shown in Table 2. An isolate belonging to ST241 (t2029) that was detected in a pus sample from AKUHN hospital was found to harbor SCCmec type IV [2B].

Out of the 16 MRSA from AKUHN, 13 were MDR including the two new spa types. Resistance was commonly seen to clindamycin, erythromycin and trimethoprim/sulfamethoxazole (TMP/SMX). A number of isolates had intermediate resistance to levofloxacin. However, two isolates were only resistant to beta lactams but susceptible to all other antibiotics including TMP/SMX as shown in Table 3. None of the MRSA was resistant to vancomycin, linezolid, mupirocin, teicoplanin or tigecycline.
Table 3

Molecular characterization and antibiotic susceptibility of MRSA isolates from AKUHN

Isolate No.

Sample

spa type

SCCmec type

Antibiogram

R

S

I

21

Pus swab

t293

IV [2B]

TOB, CLI, ERY, LEV

LNZ, TEI, VAN, TET, TIG, MUP, RIF, SXT, MOX

 

23

Sputum

t1339

UT

SXT

TOB, MOX, ERY, CLI, VAN, TET, TIG, MUP, RIF, LEV

 

79

Pus swab

t13150a

II [2A]

ERY, CLI, LEV, MOX, TOB

TET, SXT, VAN, MUP, RIF, TIG, TEI, LNZ

 

40

Urine

t648

IV [2B]

ERY, CLI, TET, SXT, VAN, MUP, MOX, RIF, TIG, TOB, TEI, LNZ, LEV

 

25

Blood

t852

IV [2B]

CLI#, ERY

LNZ, MUP, MOX, RIF, SXT, TET, TEI, TIG, TOB, VAN

LEV

35

Pus swab

t345

V [5C]

RIF, SXT, TET, TOB

CLI, ERY, LNZ, MUP, MOX, TEI, TIG, VAN

LEV

13

Pus swab

t037

III [3A]

CLI, ERY, SXT, TOB

LNZ, MUP, MOX, RIF, TET, TEI, TIG, VAN

LEV

11

Pus swab

t037

III [3A]

CLI#, SXT, TET, TOB

ERY, LNZ, MUP, MOX, RIF, TEI, TIG, VAN

LEV

89

Pus swab

t13149a

IV [2B]

TOB, SXT, ERY

CLI, LNZ, TEI, VAN, TET, TIG, MUP, RIF, LEV, MOX

 

75

Blood

t9622

IV [2B]

ERY, CLI, TET, SXT, VAN, MUP, MOX, RIF, TIG, TOB, TEI, LNZ

LEV

83

Sputum

t005

IV [2B]

TOB, ERY, CLI#

MOX, LNZ, TEI, VAN, TET, TIG, MUP, RIF, SXT

LEV

28

Nasal swab

t005

IV [2B]

ERY, CLI#, TOB, LEV

TET, SXT, VAN, LNZ, TEI, MUP, MOX, RIF, TIG

 

81

Ear swab

t1476

V [5C]

ERY, CLI#, TET, SXT, LEV

VAN, MUP, MOX, RIF, TIG, TEI, LNZ

TOB

6

Nasal swab

t091

V [5C]

SXT, TET, TOB

CLI, ERY, LNZ, MUP, MOX, RIF, TEI, TIG, VAN

LEV

29

Pus swab

t2029

IV [2B]

CLI, ERY, RIF, SXT, TET, TOB

LNZ, MUP, MOX, TEI, TIG, VAN

LEV

1

Blood

t037

III [3A]

ERY, CLI#, TET, SXT, RIF, TOB, LEV

VAN, MUP, MOX, TIG, TEI, LNZ

 

R resistant, S susceptible, I intermediate, ERY erythromycin, CLI clindamycin, CLI # inducible clindamycin resistance, TET tetracycline, SXT trimethoprim/sulfamethoxazole, VAN vancomycin, GENT gentamicin, MUP mupirocin, MOX moxifloxacin, RIF rifampicin, TIG tigecycline, TOB tobramycin, TEI teicoplanin, LNZ linezolid, LEV levofloxacin

aNew spa type

Discussion

This study reveals a markedly heterogeneous population of S. aureus isolates as well as the presence of well described MRSA clonal complexes 5, 22 and 30 that are responsible for several outbreaks worldwide [13, 26]. CC5 has been identified as the major clonal complex causing HA-MRSA in Africa with MRSA ST239/ST241-III [3A] having been identified in several African countries [6]. The main clonal complex in our study was CC5 that included ST 241, a single locus variant of ST 239 also known as the “Brazilian/Hungarian clone”. ST 239 and ST 239 like isolates are well-known epidemic clones responsible for several healthcare associated MRSA outbreaks globally. They have been found to be a cause of hospital acquired infections in other African countries including Algeria, Ghana, Morocco, South Africa and Nigeria [6]. A study done by Aiken et al. [17] in a public hospital that is approximately 40 km from Nairobi identified t037-ST239 as the predominant clone carried by inpatients in a surgical ward. Most of the nasal swabs in our study were obtained from children in a paediatric ward situated in a public referral hospital. The high proportion of t037-ST241 among our MRSA isolates is not necessarily reflective of the true prevalence of this spa type in Nairobi due to a selection bias in the manner in which the isolates were collected. Nevertheless, it is quite concerning that a clone known to be associated with MRSA epidemics is resident within hospitals in Nairobi indicating an urgent need for proper infection control interventions and regular surveillance.

Unlike the study by Aiken et al. [17] that only found one MRSA clone, we identified 18 distinct spa types amongst the MRSA isolates belonging to very diverse sequence types, including 2 MRSA spa types (t13149 and t13150) that have not previously been described. The spa type t13150 was found to belong to ST5-II [2A] which has also been found in Nigeria and Senegal [27, 28]. We identified MRSA belonging to ST22 which in Africa has only previously been found in Algeria, Tunisia and South Africa. This clone has been widely associated with hospital epidemics especially in new born units [29]. The “West Australia MRSA-2 clone” (WA-MRSA-2), ST88-IV [2B] which has been reported in Cameroon and Madagascar was not found and the European MRSA clone ST80-IV that has been found in North African countries was not present in our collection. None of the MRSA in this study belonged to spa type t008, the prevalent spa type associated with the USA300 pulsotype that has been identified as the major cause of community acquired skin and soft tissue infections in North America [30, 31]. Although the isolates included in our study were few, they represent a fairly diverse collection from both a public and private referral hospital and we can therefore conclude that USA300 is not common in Nairobi.

The 23 MSSA belonged to 22 different spa types highlighting their marked genetic diversity in contrast to the MRSA. There were 3 spa types (t005, t318 and t1476) that were found in both MSSA and MRSA suggesting the possibility of local acquisition of an SCCmec element. One of the MSSA spa types belongs to t002 which is associated with the MRSA pulsotype USA100 [16]. The spa type t064 was also found which is associated with one of the major MRSA clones (ST612- SCCmec IV [2B] found in South Africa [32]. ST241 has frequently been associated with SCCmec III [3A], however, one isolate belonging to ST241 harbored SCCmec IV [2B] (this SCCmec element was more common in AKUHN hospital). This particular clone was previously observed in a large university clinic in Nigeria [33]. SCCmec types IV and V are small in size and can be transmitted both in the community and healthcare settings. Potentially, this could result in the emergence of well-known epidemic MRSA clones like the predominant European CA-MRSA clone ST80-IV [2B] whose for bearer is thought to be a PVL-positive MSSA from sub-Saharan Africa that acquired the SCCmec IV [2B] [34]. The MSSA strain t021-ST30 has also been associated with a known PVL positive CA-MRSA clone [35].

The multi-drug resistant patterns for the MRSA in this study are in keeping with what has been described in other countries in Africa [17, 32, 36, 37]. Most of the MRSA were resistant to macrolide–lincosamide, tetracycline and sulphonamide group of antibiotics which is fairly common amongst MRSA especially those that are healthcare associated. However two of the isolates showed resistance to only beta lactam antibiotics suggesting that they may be community acquired (based on their molecular structure) given that they belonged to SCCmec type IV which has been associated with CA-MRSA.

The major limitation of this study is that the isolates characterized were not collected in a structured and consistent manner and as such the proportions reported do not necessarily represent a true picture of the relative distributions of different clones in Nairobi due to a selection bias. The over representation of nasal swab specimens from a paediatric population from one hospital may have exaggerated the prevalence of t037-ST 241. We also did not carry out MLST and spa typing on all isolates due to financial constraints. However, we did ensure that a representative isolate from each PFGE clonal complex was included in the isolates that were further characterized using MLST and spa typing.

Conclusion

To the best of our knowledge, this is the largest study from Kenya that has carried out PFGE, MLST, spa and SCCmec typing on a diverse collection of MRSA isolates. This study highlights the marked genetic diversity of MSSA and MRSA isolates in Nairobi including the presence of well-known epidemic MRSA clones and new MRSA spa types. Given the evolution of S. aureus over the years, there is need for continuous surveillance in order to keep track of emerging clones. The existence of epidemic MRSA clones further justifies the need to strengthen infection control measures within our hospitals so as to avoid nosocomial S. aureus infections.

Abbreviations

AKUHN: 

Aga Khan University Hospital Nairobi

BURP: 

based upon repeat pattern

CC: 

clonal complex

CLSI: 

Clinical Laboratory Standards Institute

DNA: 

deoxyribonucleic acid

dNTP: 

deoxynucleotide triphosphate

EDTA: 

ethylene-diamine-tetraacetic acid

KEMRI: 

Kenya Medical Research Institute

MDR: 

multidrug resistance

MLST: 

multi-locus sequence Type

MSSA: 

methicillin susceptible Staphylococcus aureus

MRSA: 

methicillin resistant Staphylococcus aureus

ND: 

not defined

NF: 

no founder

PBP2a: 

penicillin binding protein 2a

PCR: 

polymerase chain reaction

S. aureus

Staphylococcus aureus

SCCmec

Staphylococcal cassette chromosome mec

ST: 

sequence type

UT: 

untypeable

Declarations

Authors’ contributions

GO conceptualized the study, collected isolates, carried out molecular analysis and drafted the manuscript. KNVZ and KH assisted in molecular analysis of samples and drafting of the manuscript. SA helped in carrying out BURP and eBURST analysis, drafting and critiquing the manuscript. SK, AW and GV assisted in designing the study, getting samples, interpreting of results and drafting the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We acknowledge the use of the S. aureus MLST database which is located at Imperial College London and is funded by the Wellcome Trust.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets analysed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

This being a low risk study, a waiver from full ethics review was granted by the AKUHN research ethics committee (2016/REC-33).

Funding

All the molecular work was done in the Microbiology section, Department of Pathology, Tygerberg Hospital, Cape Town, South Africa. This was facilitated through a technology transfer grant awarded to Prof Andrew Whitelaw by Stellenbosch University.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Pathology, Aga Khan University Hospital Nairobi
(2)
Division of Medical Microbiology, Department of Pathology, Stellenbosch University
(3)
Division of Medical Microbiology, Department of Pathology, Faculty of Health Sciences, University of Cape Town, South Africa
(4)
Center of Microbiology Research, Kenya Medical Research Institute

References

  1. Diekema DJ, Pfaller MA, Schmitz FJ, Smayevsky J, Bell J, Jones RN, Beach M. Survey of infections due to Staphylococcus species: frequency of occurrence and antimicrobial susceptibility of isolates collected in the United States, Canada, Latin America, Europe, and the Western Pacific region for the SENTRY Antimicrobial Surveillanc. Clin Infect Dis. 2001;32(Suppl 2):S114–32.View ArticlePubMedGoogle Scholar
  2. Chambers HF. The changing epidemiology of Staphylococcus aureus? Emerg Infect Dis. 2001;7:178–82.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Grundmann H, Aires-de-Sousa M, Boyce J, Tiemersma E. Emergence and resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat. Lancet. 2006;368:874–85.View ArticlePubMedGoogle Scholar
  4. Seybold U, Kourbatova EV, Johnson JG, Halvosa SJ, Wang YF, King MD, Ray SM, Blumberg HM. Emergence of community-associated methicillin-resistant Staphylococcus aureus USA300 genotype as a major cause of health care-associated blood stream infections. Clin Infect Dis. 2006;42:647–56.View ArticlePubMedGoogle Scholar
  5. Chambers HF. Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev. 1997;10:781–91.PubMedPubMed CentralGoogle Scholar
  6. Abdulgader SM, Shittu AO, Nicol MP, Kaba M. Molecular epidemiology of methicillin-resistant Staphylococcus aureus in Africa: a systematic review. Front Microbiol. 2015;6:348.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Omuse G, Kabera B, Revathi G. Low prevalence of methicillin resistant Staphylococcus aureus as determined by an automated identification system in two private hospitals in Nairobi, Kenya: a cross sectional study. BMC Infect Dis. 2014;14:669.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Maina EK, Kiiyukia C, Wamae CN, Waiyaki PG, Kariuki S. Characterization of methicillin-resistant Staphylococcus aureus from skin and soft tissue infections in patients in Nairobi, Kenya. Int J Infect Dis. 2012;17:e115–9.View ArticlePubMedGoogle Scholar
  9. Zinn CS, Westh H, Rosdahl VT. An international multicenter study of antimicrobial resistance and typing of hospital Staphylococcus aureus isolates from 21 laboratories in 19 countries or states. Microb Drug Resist. 2004;10:160–8.View ArticlePubMedGoogle Scholar
  10. Cookson BD. Methicillin-resistant Staphylococcus aureus in the community: new battlefronts, or are the battles lost? Infect Control Hosp Epidemiol. 2000;21:398–403.View ArticlePubMedGoogle Scholar
  11. Falagas ME, Karageorgopoulos DE, Leptidis J, Korbila IP. MRSA in Africa: filling the global map of antimicrobial resistance. PLoS ONE. 2013;8:e68024.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Chatterjee SS, Otto M. Improved understanding of factors driving methicillin-resistant Staphylococcus aureus epidemic waves. Clin Epidemiol. 2013;5:205–17.PubMedPubMed CentralGoogle Scholar
  13. Stefani S, Chung DR, Lindsay JA, Friedrich AW, Kearns AM, Westh H, Mackenzie FM. Meticillin-resistant Staphylococcus aureus (MRSA): global epidemiology and harmonisation of typing methods. Int J Antimicrob Agents. 2012;39:273–82.View ArticlePubMedGoogle Scholar
  14. Enright MC, Robinson DA, Randle G, Feil EJ, Grundmann H, Spratt BG. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc Natl Acad Sci USA. 2002;99:7687–92.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Bozdoğan B, Yıldız O, Oryaşın E, Kırdar S, Gülcü B, Aktepe O, Arslan U, Bayramoğlu G, Coban AY, Coşkuner SA, Güdücüoğlu H, Karabiber N, Oncü S, Tatman Otkun M, Ozkütük N, Ozyurt M, Sener AG. t030 is the most common spa type among methicillin-resistant Staphylococcus aureus strains isolated from Turkish hospitals. Mikrobiyol Bul. 2013;47:571–81.View ArticlePubMedGoogle Scholar
  16. David MZ, Taylor A, Lynfield R, Boxrud DJ, Short G, Zychowski D, Boyle-Vavra S, Daum RS. Comparing pulsed-field gel electrophoresis with multilocus sequence typing, spa typing, Staphylococcal Cassette Chromosome mec (SCC mec) typing, and PCR for Panton–Valentine Leukocidin, arcA, and opp3 in methicillin-resistant Staphylococcus aureus Isola. J Clin Microbiol. 2013;51:814–9.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Aiken AM, Mutuku IM, Sabat AJ, Akkerboom V, Mwangi J, Scott JAG, Morpeth SC, Friedrich AW, Grundmann H. Carriage of Staphylococcus aureus in Thika level 5 Hospital, Kenya: a cross-sectional study. Antimicrob Resist Infect Control. 2014;3:22.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Robinson DA, Enright MC. Evolution of Staphylococcus aureus by large chromosomal replacements. J Bacteriol. 2004;186:1060–4.View ArticlePubMedPubMed CentralGoogle Scholar
  19. de Aires de Sousa M, Sanches IS, Ferro ML, Vaz MJ, Saraiva Z, Tendeiro T, Serra J, de Lencastre H. Intercontinental spread of a multidrug-resistant methicillin-resistant Staphylococcus aureus clone. J Clin Microbiol. 1998;36:2590–6.PubMedGoogle Scholar
  20. Xu BL, Zhang G, Ye HF, Feil EJ, Chen GR, Zhou XM, Zhan XM, Chen SM, Pan WB. Predominance of the Hungarian clone (ST 239-III) among hospital-acquired meticillin-resistant Staphylococcus aureus isolates recovered throughout mainland China. J Hosp Infect. 2009;71:245–55.View ArticlePubMedGoogle Scholar
  21. Edgeworth JD, Yadegarfar G, Pathak S, Batra R, Cockfield JD, Wyncoll D, Beale R, Lindsay JA. An outbreak in an intensive care unit of a strain of methicillin-resistant Staphylococcus aureus sequence type 239 associated with an increased rate of vascular access device-related bacteremia. Clin Infect Dis. 2007;44:493–501.View ArticlePubMedGoogle Scholar
  22. Wayne P. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement. M100-S20. Clin Lab Stand Inst. 2010:29.Google Scholar
  23. CDC. Oxacillin—resistant Staphylococcus aureus on PulseNet (OPN): Laboratory Protocol for Molecular Typing of S. aureus by Pulsed—field gel electrophoresis (pfge) growing cultures : plug preparation . Natl Mol Subtyping Netw foodborne Dis Surveill. 2013:1–24.Google Scholar
  24. Milheirico C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother. 2007;51:4537.View ArticlePubMed CentralGoogle Scholar
  25. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008–15.PubMedPubMed CentralGoogle Scholar
  26. Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol. 2008;8:747–63.View ArticlePubMedGoogle Scholar
  27. Breurec S, Fall C, Pouillot R, Boisier P, Brisse S, Diene-Sarr F, Djibo S, Etienne J, Fonkoua MC, Perrier-Gros-Claude JD, Ramarokoto CE, Randrianirina F, Thiberge JM, Zriouil SB, Garin B, Laurent F. Epidemiology of methicillin-susceptible Staphylococcus aureus lineages in five major African towns: high prevalence of Panton–Valentine leukocidin genes. Clin Microbiol Infect. 2011;17:633–9.View ArticlePubMedGoogle Scholar
  28. Raji A, Ojemhen O, Umejiburu U, Ogunleye A, Blanc DS, Basset P. High genetic diversity of Staphylococcus aureus in a tertiary care hospital in Southwest Nigeria. Diagn Microbiol Infect Dis. 2013;77:367–9.View ArticlePubMedGoogle Scholar
  29. Pinto AN, Seth R, Zhou F, Tallon J, Dempsey K, Tracy M, Gilbert GL, O’Sullivan MVN. Emergence and control of an outbreak of infections due to Panton–Valentine leukocidin positive, ST22 methicillin-resistant Staphylococcus aureus in a neonatal intensive care unit. Clin Microbiol Infect. 2013;19:620–7.View ArticlePubMedGoogle Scholar
  30. Al-Rawahi GN, Reynolds S, Porter SD, Forrester L, Kishi L, Chong T, Bowie WR, Doyle PW. Community-associated CMRSA-10 (USA-300) is the predominant strain among methicillin-resistant Staphylococcus aureus strains causing skin and soft tissue infections in patients presenting to the emergency department of a Canadian tertiary care hospital. J Emerg Med. 2010;38:6–11.View ArticlePubMedGoogle Scholar
  31. Ray GT, Suaya JA, Baxter R. Incidence, microbiology, and patient characteristics of skin and soft-tissue infections in a U.S. population: a retrospective population-based study. BMC Infect Dis. 2013;13:252.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Shittu A, Nübel U, Udo E, Lin J, Gaogakwe S. Characterization of meticillin-resistant Staphylococcus aureus isolates from hospitals in KwaZulu-Natal province, Republic of South Africa. J Med Microbiol. 2009;58(Pt 9):1219–26.View ArticlePubMedGoogle Scholar
  33. Ghebremedhin B, Olugbosi MO, Raji AM, Layer F, Bakare RA, Konig B, Konig W. Emergence of a community-associated methicillin-resistant Staphylococcus aureus strain with a unique resistance profile in Southwest Nigeria. J Clin Microbiol. 2009;47:2975–80.View ArticlePubMedPubMed CentralGoogle Scholar
  34. Stegger M, Wirth T, Andersen PS, Skov RL, De Grassi A, Simões PM, Tristan A, Petersen A, Aziz M, Kiil K, Cirković I, Udo EE, del Campo R, Vuopio-Varkila J, Ahmad N, Tokajian S, Peters G, Schaumburg F, Olsson-Liljequist B, Givskov M, Driebe EE, Vigh HE, Shittu A, Ramdani-Bougessa N, Rasigade J-P, Price LB, Vandenesch F, Larsen AR, Laurent F. Origin and evolution of European community-acquired methicillin-resistant Staphylococcus aureus. MBio. 2014;5:e01044.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Monecke S, Coombs G, Shore AC, Coleman DC, Akpaka P, Borg M, Chow H, Ip M, Jatzwauk L, Jonas D, Kadlec K, Kearns A, Laurent F, O’Brien FG, Pearson J, Ruppelt A, Schwarz S, Scicluna E, Slickers P, Tan HL, Weber S, Ehricht R. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One. 2011;6:e17936.View ArticlePubMedPubMed CentralGoogle Scholar
  36. Egyir B, Guardabassi L, Sørum M, Nielsen SS, Kolekang A, Frimpong E, Addo KK, Newman MJ, Larsen AR. Molecular Epidemiology and antimicrobial susceptibility of clinical Staphylococcus aureus from Healthcare Institutions in Ghana. PLoS ONE. 2014;9:e89716.View ArticlePubMedPubMed CentralGoogle Scholar
  37. Marais E, Aithma N, Perovic O, Oosthuysen WF, Musenge E, Dusé AG. Antimicrobial susceptibility of methicillin-resistant Staphylococcus aureus isolates from South Africa. S Afr Med J. 2009;99:170–3.PubMedGoogle Scholar

Copyright

© The Author(s) 2016

Advertisement