Open Access

Molecular characterization of selected multidrug resistant Pseudomonas from water distribution systems in southwestern Nigeria

  • Ayodele T. Adesoji1Email author,
  • Adeniyi A. Ogunjobi2 and
  • Isaac O. Olatoye3, 4
Annals of Clinical Microbiology and Antimicrobials201514:39

https://doi.org/10.1186/s12941-015-0102-4

Received: 20 May 2015

Accepted: 19 August 2015

Published: 2 September 2015

Abstract

Background

Persistence of antibiotic resistant bacteria, including multidrug resistant (MDR) pseudomonads, is an important environmental health problem associated with drinking water distribution systems (DWDS) worldwide. There is paucity of data on the molecular characteristics of antibiotic resistance genes and their mode of transfer among pseudomonads from DWDS located in resource-challenged areas such as southwestern Nigeria.

Methods

MDR pseudomonads (n = 22) were selected from a panel of 296 different strains that were isolated from treated and untreated water in six DWDS located across southwest Nigeria. Primarily, the isolated pseudomonads strains were identified by 16S rDNA sequencing and antibiotic-resistance testing was completed using agar breakpoints assays. The final panel of strains of resistant to more than three classes of antibiotics (i.e. MDR), were further characterized by PCR genotyping, Sanger sequencing, and plasmid profiling.

Results

Pseudomonad resistance to gentamicin and streptomycin ranged from 22.7 to 54.6 % while resistance to tetracycline, ceftiofur and sulphamethoxazole ranged from 40.9 to 77.3 %. The most commonly detected antibiotic resistance genes were tet(A) (31.8 % of isolates), sul1 (31.8 %), bla TEM (40.9 %) and aph(3″) c (36.4 %). Class 1 integron sequences were evident in 27.3 % of isolates and they harbored genes encoding resistance to aminoglycosides (aadA2, aadA1), trimethoprim (dfrA15, dfr7) and sulphonamide (sul1) while the plasmid ranged between 22 and 130 kb.

Conclusions

Pseudomonas spp, isolated from these DWDS possess resistance genes and factors that are of public and environmental health significance. Therefore, has the potential of contributing to the global scourge of resistance genes transfer in human, animals and environments, thereby, useful in the epidemiology of antimicrobial resistance.

Keywords

Pseudomonas spp Antibiotic resistance genes Multidrug resistance Water distribution systems

Background

Pseudomonas spp, is a ubiquitous and diverse genus of Gram-negative bacteria that can be found in soil, water, decaying vegetation and animals. According to Craun et al. [1], Pseudomonas was one of the most frequently identified agents associated with waterborne outbreaks of dermatitis (rash or folliculitis), as well as conjunctivitis, otitis externa and other symptoms from recreational water in the US Pseudomonads are well adapted to survival in the warm temperatures found in whirlpools, hot tubs and indoor pools.

The most important and ubiquitous pathogenic pseudomonad is P. aeruginosa. It is medically significant and has a high intrinsic resistance to antibiotics while causing wide spectrum of opportunistic infections [2]. P. aeruginosa is best known for chronic lung infections among cystic fibrosis patients [3]. P. aeruginosa is also a cause of serious infections among immunocompromised cancer patients, burn patients, catheterized patients, and other hospitalized individuals [2].

Antibiotic resistance genes can be transferred between different microorganisms [4]. Mobile genetic elements such as plasmids, transposons and integrons contribute to P. aeruginosa multidrug resistance [58]. There is, however, a paucity of information about the molecular basis for antibiotic resistance for environmental Pseudomonas in southwestern Nigeria. Hence, we characterized selected multidrug resistant bacteria from water distribution systems from southwestern Nigeria using 16S rDNA sequencing and PCR genotyping.

Methods

Bacterial isolates

Independent multidrug resistant Pseudomonas isolates (n = 22) were selected between December 2010 and July 2011 from a pool of two hundred and ninety-one different bacteria genera from raw, treated and municipal taps of six selected water distribution systems in Ife, Ede, Asejire, Eleyele, Owena-Ondo and Owena-Idanre, in southwestern Nigeria. Methods for sampling and bacterial isolation were described previously [10]. Isolates were stored in freezing medium at −80 °C in 96-well plates until analysis.

Description of sample locations

The description of these dams’ water distribution systems selected for this study is in our previous publications [911]. However, for clarity of this paper, raw water samples were taken from the untreated water from the dam at the point of entering the water treatment plants before passing through the plant. Treated water samples were taken from the final water after passing through all purification stages from the treatment plants before pumping to the municipal taps for public consumption while samples from the municipal taps were taking from the taps at the point of public consumption.

Extraction of DNA and molecular characterization of bacteria using 16S rDNA

The stock culture was streaked on Luria Betani (LB) agar and grown overnight. Afterwards, total genomic DNA was extracted by dispensing 200 µl of 5 % chelex in a tube. A loopful of the overnight grown colony of bacterium from LB agar was then inoculated into the solution. The mixture was then boiled at 100 °C for 10 min and centrifuge at 13 k×g for 1 min. Five microliter of the supernatant which consist of the extracted DNA was then used as template with 2 mM MgCl2, 0.8 mM dNTPs, 0.2 µl of primer 1 and primer 2 and 1× PCR buffer. The reaction condition include 1 min denaturation (95 °C) followed by 30 cycles of 96 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s and a final extension of 72 °C for 10 min. PCR products were then separated and visualized on 1 % agarose gel electrophoresis to confirm amplification. The 16S rDNA sequence was amplified using 16s-8F (AGAGTTTGATCMTGGCTCAG) and 16s-517 (ATTACCGCGGCTGCTGG) primers. PCR products were sequenced (Eurofins MWG, USA) and manual base calls and sequence trimming was completed by sequencer (5.0) BLAST [12] was used to identify close sequence matches (http://www.ncbi.nlm.nib.gov/BLAST/blast).

Phylogenetic tree construction

Phylogenetic relatedness of the 16s rDNA genes of these Pseudomonas was compared with 12 downloaded 16s rDNA sequences of other species from the gene bank. Sequences were aligned by multiple sequence alignment technique using CLUSTAL W [13] and a phylogenetic tree constructed by the neighbor joining method [14] using MEGA version 5 [15]. Azotobacter chroococcum (JQ692178)’s 16s rDNA was used as an outgroup.

Antimicrobial drug susceptibility and selection of multi-drug resistant Pseudomonas spp

Multi-drug resistant Pseudomonas was selected based on their resistance to over three classes of antibiotics. This was carried out after assessing antibiotic resistant properties of the Pseudomonas using break point assays on LB agar plates [9]. This involves autoclaving of LB agar and cooling down to 45 °C in a water bath and seeding with antibiotics of specific concentration (Table 1) based on Clinical Laboratory Standards Institute (CLSI) standard for gram negative bacteria [16]. Afterwards, the medium was then poured into Petri dishes (150 × 15 mm) and allowed to set. Overnight culture were then stabbed from 96-well plate onto agar plate using 96-well pin replicator and incubated overnight at 37 °C. Isolates were scored as ‘1’ for growth and ‘0’ for no growth on each antibiotics plate. It should be noted that E. coli strain K12 was used as negative control while E. coli strain H5N was used as positive control.
Table 1

Antibiotic concentrations tested against Pseudomonas spp

Code

Name

Concentration (µg/ml)

FF

Florfenicol

16

T

Tetracycline

16

S

Streptomycin

16

G

Gentamycin

16

K

Kanamycin

64

C

Chloramphenicol

32

N

Nalidixic acid

30

AMC

Amoxicillin/clavulanic acid

32/16

CEF

Ceftiofur

12

SU

Sulfamethoxazole

512

SXT

Sulfamethoxazole/trimethoprim

76/4

Assessing antibiotic resistance genes

In this study, six tetracycline, three sulfonamide, three extended β-lactamase and three streptomycin/spectinomycin resistance genes were amplified using specific primer specific for each gene and the annealing temperature as described in Table 2. The amplification of all the genes was carried out using 5 µl of the chelex extracted DNA as template for the PCR mixture with 5 µl of PCR buffer (1×), 2 µl of MgCl2 (2 mM), 1 µl of dNTPs 0.8 mM and 1 µl (0.2 µl) each of the forward and reverse primers in a thermo cycler (Model: Bio Rad Laboratories, Richmond, CA, USA). The condition for the amplification of the genes include: 1 min of denaturation of 95 °C followed by 30 cycles of 96 °C for 30 s 60 °C for 30 s and 72 °C for 30 s and final extension of 72 °C for 10 min. All these conditions remain the same during the amplification of the genes except the annealing temperature which is described in Table 2. PCR products were then separated and visualized on 1 % agarose gel electrophoresis to confirm amplification.
Table 2

Primers used in this study for amplification of class 1 and class 2 integrons and other antibiotic resistant genes

Primer pair

Target

Sequence (5´–3´)

Annealing temperature (◦C)

Amplicon size (bp)

References

Primer 1 16s-8F

16S rDNA

AGAGTTTGATCMTGGCTCAG

60

456

[36]

Primer 2 16s-517

16S rDNA

ATTACCGCGGCTGCTGG

60

456

[37]

IntI1_F

Class 1 integrase gene

CCTCCCGCACGATGATC

55

270

[38]

IntI1_R

TCCACGCATCGTCAGGC

IntI2_F

Class 2 integrase gene

TTATTGCTGGGATTAGGC

50

233

[39]

IntI2_R

ACGGCTACCCTCTGTTATC

5′_CS

Class 1 integron variable region

GGCATCCAAGCAGCAAG

58.5

Variable

[40]

3′_CS

AAGCAGACTTGACCTGA

Hep_F

Class 2 integron variable region

CGGGATCCCGGACGGCATGCACGATTTGTA

60

Variable

[41]

Hep_R

GATGCCATCGCAAGTACGAG

Sul1-F

sul1

CGGCGTGGGCTACCTGAACG

60

433

[42]

Sul1-R

GCCGATCGCGTGAAGTTCCG

Sul2-F

sul2

GCGCTCAAGGCAGATGGCATT

60

293

[42]

Sul2-R

GCGTTTGATACCGGCACCCGT

pVP440sul3F

sul3

TCAAAGCAAAATGATATGAGC

55

787

[42]

pVP440sul3R

TTTCAAGGCATCTGATAAAGAC

qacEΔ1F

qacEΔ1F

ATC GCA ATA GTT GGC GAA GT

58

800

[43]

sul1-B

sul1-B

GCA AGG CGG AAA CCC GCG CC

58

 

[44]

aph (3″)c-F

aph (3″)c

GCTCAAAGGTCGAGGTGTGG

55

515

[27]

aph (3″)c-R

CCAGTTCTCTTCGGCGTTAG

55

515

[27]

ant (3″)b-F

ant (3″)b

CAGCGCAATGACATTCTTGC

55

295

[27]

ant (3″)b-F

GTCGGCAGCGACA(C/T)CCTTCG

55

295

[27]

aph(6)-1dd-F

aph(6)-1dd

GACTCCTGCAATCGTCAAGG

55

560

[27]

aph(6)-1dd-R

GCAATGCGTCTAGGATCGAG

55

560

[27]

tet(A)-F

tet(A)

TTGGCATTCTGCATTCACTC

60

494

[45]

tet(A)-R

GTATAGCTTGCCGGAAGTCG

60

494

[45]

tet(B)-F

tet(B)

CAGTGCTGTTGTTGTCATTAA

60

571

[45]

tet(B)-R

GCTTGGAATACTGAGTGTAA

60

571

[45]

tet(E)-F

tet(E)

TATTAACGGGCTGGCATTTC

55

544

[45]

tet(E)-R

AGCTGTCAGGTGGGTCAAAC

55

544

[45]

tet(M)-F

 

ACACGCCAGGACATATGGAT

55

536

[45]

tet(M)-R

tet(M)

ATTTCCGCAAAGTTCAGACG

55

536

[45]

tet(30)-F

tet(30)

CCGTCATGCAATTTGTGTTC

55

550

[45]

tet(30)-R

TAGAGCACCCAGATCGTTCC

55

550

[45]

SHV_F

bla SHV

GCGAAAGCCAGCTGTCGGGC

62

538

[46]

SHV_R

GATTGGCGGCGCTGTTATCGC

62

538

[46]

CTX_F

bla CTX-M

GTGCAGTACCAGTAAAGTTATGG

55

538

[46]

CTX_R

CGCAATATCATTGGTGGTGCC

 

538

[46]

TEM_F

bla TEM

AAAGATGCTGAAGATCA

44

425

[46]

TEM_R

TTTGGTATGGCTTCATTC

 

425

[46]

Assessing class 1 and 2 integrons

The integrase genes of class 1 and class 2 were amplified by the use of PCR using 5 µl of DNA template extracted by chelex method described above as template. Primer specific for the integrase gene and variable region was selected as described on Table 2. Condition for the PCR was also as described above except for the annealing temperature which was as described on Table 2. It should be noted that after amplification of gene cassette of both Class 1 and Class 2 integrons using 5′-CS/3′-CS and hep_F/hep_R, respectively. PCR products of the amplified genes were used for sequencing (Eurofins MWG, USA). The putative gene cassettes harboured on the integrase sequences were determined through online similarity searches using the BLAST software in the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/).

Determination of presence of plasmid on bacteria isolates

Bacteria (Pseudomonas isolates) were grown on Luria–Bertani (LB) agar overnight and a single colony was picked and inoculated overnight as well in LB Broth. One hundred and fifty microliter of the culture was later pelleted from the culture by centrifugation for 10 min at 1000×g. The supernatant was removed and re-suspended in 100 µl of lysis buffer (3 % SDS, 50 mM Tris pH 12.6 with 50 mM Tris adjusted by 1.6 ml 2 N NaOH up to 100 ml final volume). The mixture was incubated at 55 °C for 1 h. The resulting plasmid was extracted with 150 µl of phenol:chloroform (1:1, v/v, pH 7.9) and mixed by inversion several times before spinning at highest speed for 10 min. Fifty microliter of the supernatant was transferred into a new tube and mixed with 10 µl of 10× loading dye (Invitrogen). The mixture containing the plasmid was run on 1 % agarose gel electrophoresis in 1× TAE (tris-acetate buffer).

Results

Bacteria isolates

In this study, 22 MDR Pseudomonas were identified by 16S rDNA out of a total of 296 different strains that were isolated from all sampled water as P. putida, P. fluorescens and P. otitidis (Table 3). Phylogenetic studies showed 10 of the Pseudomonads to be in single distinct cluster with P. graminis (KC790241.1) from leaf of Wasabia japonica from China, P. putida (JQ968690.1) from activated sludge in China, Pseudomonas spp (AB302400.1) from Japan and uncultured bacterium (HQ121069.1) from USA. Others such as Pseudomonas spp (JF683300) and Pseudomonas spp (FM161425.1) from Ede municipal tap and Asejire treated water, respectively belong to the same cluster (Fig. 1).
Table 3

Phenotypes, antibiotics resistance gene and integrons among MDR Pseudomonas spp

Source

Strain ID

Bacteria

Phenotype

tet(A)

tet (B)

tet (E)

tet(M)

tet (30)

Sul 1

Sul 2

blaSHV

blaCTX

blaTEM

aph (3″) c

ant (3″) b

aph (6)1d d

int 1

v 1

int 2

v 2

IRW

96b

P. putida

FF, T, CEF, SU, AMC

IFW

89

P. putida

T, S, G, K, C, SXT, AMC, SU

+

+

+

+

+

+

EDRW

299A

P. otitidis

FF, C, SXT, AMC, SU

EDRW

99A

P. putida

FF, SXT, AMC

+

EDRW

299B2

P. otitidis

FF, CEF, AMC, SU

+

EDM1

159B

P. fluorescens

T, S, G, N, CEF, SXT

+

EDM1

304A

P. otitidis

T, SU, SXT, AMC, S, G, CEF, FF

+

+

EDM1

306A

P. otitidis

FF, CEF, AMC, SU

EDM1

85B

P. putida

SXT, AMC, C, FF

+

+

EDM1

106

P. putida

T, SU, SXT, AMC, S, N

+

AFW

6B

P. fluorescens

T, S, G, K, CEF, SXT

+

AFW

6A

P. fluorescens

T, S, G, K, C, CEF, SXT, AMC, SU, FF

+

+

+

+

+

+

+

+

OWODFW

350

P. otitidis

SXT, SU

+

OWODM1

260

P. putida

FF, T, C, N, CEF, SXT, AMC, SU

+

+

OWODM2

251B

P. putida

T, S, C, SXT, SU

+

+

+

+

+

+

+

+

+

OWIRW

343B

P. otitidis

FF, T, S, N, CEF, AMC, SU

+

+

+

OWIRW

343A

P. otitidis

FF, K, C, SXT, N, CEF, AMC, SU

+

OWIRW

223

P. otitidis

FF, S, C, CEF, SXT, AMC, SU

+

OWRW

175B

P. putida

T, S, C, K, CEF, SXT, AMC, SU

+

+

+

+

+

+

+

+

OWIRW

342A

P. otitidis

FF, AMC, CEF, SU

OWIM1

196

P. putida

FF, T, S, G, K, AMC, SU

+

+

+

+

+

+

+

+

OWIM2

244B

P. putida

FF, T, S, G, K, C, SXT, AMC, SU

+

+

+

+

+

+

+

+

+

+

   

Total

7

0

1

0

1

7

6

5

0

9

8

8

3

6

   
   

Percentages

31.8

0

4.6

0

4.6

31.8

27.3

27.3

0

40.9

36.4

36.4

13.6

27.3

   

Antibiotics code: FF florfenicol, T tetracycline, S streptomycin, G gentamicin, K kanamycin, C chloramphenicol, N nalidixic acid, AMC amoxicillin/clavulanic acid, CEF ceftiofur, SU sulfamethoxazole, SXT sulfamethoxazole/trimethoprim

Source code: IFW Ife treated water, EDM1 Ede municipal Tap 1, AFW Asejire treated water, OWODM2 Owena Ondo Municipal Tap 2, OWIRW Owena-Idanre raw water, OWIM1 Owena-Idanre Municipal Tap 1, OWIM2 Owena-Idanre Municipal Tap 2

Fig. 1

Phylogenetic relationship of 16S rDNA of Pseudomonas spp from south western Nigeria water distribution system with sequence from gene bank

Antimicrobial susceptibility

Figure 2 and Table 3 showed the results of the percentage resistance of the studies bacteria and their phenotypic patterns of resistance, respectively. We observed among the studied Pseudomonas higher resistance to florfenicol (63.6 %), tetracycline (59.1 %), streptomycin (54.6 %), ceftiofur (59.1 %), amoxicillin/clavulanic acid (81.8 %), sulfamethoxazole (77.3 %) compared to chloramphenicol (40.9 %), gentamicin (31.8 %), kanamycin (31.8 %) and nalidixic acid (22.7 %). From these results, it was noticed that these isolates were more resistant to older generation antibiotics (such as sulfamethoxazole, tetracycline, streptomycin etc.) than new generation antibiotics such as (gentamicin, kanamycin and nalidixic acid). We also saw that out of 22 Pseudomonas spp isolated from all the sampled area 21 were multi-drug resistant (MDR) (Table 3). The MDR bacteria were selected based on resistant to over three classes of antibiotics.
Fig. 2

Percentage resistance of Pseudomonas spp to various antibiotics. FF florfenicol, T tetracycline, S streptomycin, G gentamicin, K kanamycin, C chloramphenicol, N nalidixic acid, AMC amoxicillin/clavulanic acid, CEF ceftiofur, SU sulfamethoxazole, SXT sulfamethoxazole/trimethoprim

Molecular characterization of antibiotic resistance genes

Beyond the phenotypic determination, we tested for the presence of some antibiotic resistance genes which could have been mediating the antibiotic resistance in the Pseudomonas spp. Among the tetracycline resistance gene tested i.e. tet(A), tet(B), tet(E) and tet30 encoding resistant by efflux pump mechanism and tet(O) and tet(M) encoding resistant by protection of the ribosome. We observed that tet(A) was the highest occurred (31.8 %) followed by tet(E) and tet30 (4.5 %) (Table 3). We did not detect tet(B), tet(M) and tet(O) among the Pseudomonas isolates. Among three sulphonamide resistance genes tested for in this study. It was observed that sul 1 was the highest (31.8 %) detected followed by sul 2 (27.3 %) (Table 3). Sul 3 was not detected in any of the Pseudomonas while among the three extended beta lactamase (ESBL) genes: bla SHV, bla CTX, bla TEM, we observed that bla TEM was the highest (40.9 %) detected followed by bla SHV (27.3 %) while bla CTX was not detected at all (Table 3).

We also observed the presence of all three streptomycin resistance genes tested for in at least one of the isolates (Table 3). Aph(3″) c and ant(3″) was the most detected, each was observed to be present in 36.4 % of isolates tested while aph (6)1d d was the least (13.7) detected. Class 2 integron was not detected in any of the isolates (Table 3). Whereas, 6 (27.3 %) of the isolates showed the occurrence of class 1 integron.

Plasmid profiling

The presence of plasmid was observed in 10 (45.5 %) out of 22 Pseudomonas studied (Table 4). Each of the bacteria was observed to be carrying 1 plasmid each ranging between 22 and 130 kb in size. None of the bacteria showed the occurrence of more than one plasmid.
Table 4

Plasmid carrying Pseudomonas spp. isolated from selected water samples from southwestern Nigeria

Source

Bacteria/strain ID

Resistant phenotypes

No of plasmid and size

IFW

Pseudomonas sp (89)

T, S, G, K, C, SXT, AMC, SU

1 (95 kb)

EDM1

Pseudomonas sp (306A)

FF, CEF, AMC, SU

1 (95 kb)

AFW

Pseudomonas sp (6A)

T, S, G, K, C, CEF, SXT, AMC, SU, FF

1 (95 kb)

AFW

Pseudomonas sp (6B)

T, S, G, K, CEF, SXT

1 (95 kb)

OWODM2

Pseudomonas putida (251B)

T, S, C, SXT, SU

1 (22 kb)

OWIRW

Pseudomonas sp (175B)

T, S, C, K, CEF, SXT, AMC, SU

1 (55 kb)

OWIRW

Pseudomonas sp (342A)

FF, AMC, CEF, SU

1 (130 kb)

OWIRW

Pseudomonas sp (343B)

FF, T, S, N, CEF, AM, AMC, SU

1 (130 kb)

OWIM1

Pseudomonas sp (196)

FF, T, S, G, K, AM, AMC, SU

1 (120 kb)

OWIM2

Pseudomonas sp (244B)

FF, T, S, G, K, C, AM, SXT, AMC, SU

1 (130 kb)

Antibiotics code: FF florfenicol, T tetracycline, S streptomycin, G gentamicin, K kanamycin, C chloramphenicol, N nalidixic acid, AMC amoxicillin/clavulanic acid, CEF ceftiofur, SU sulfamethoxazole, SXT sulfamethoxazole/trimethoprim

Source code: IFW Ife treated water, EDM1 Ede municipal Tap 1, AFW Asejire treated water, OWODM2 Owena Ondo Municipal Tap 2, OWIRW Owena-Idanre raw water, OWIM1 Owena-Idanre Municipal Tap 1, OWIM2 Owena-Idanre Municipal Tap 2

Discussion

Pseudomonad is one of the most important and ubiquitous pathogen that is significantly important medically [17]. Aquatic ecosystems could serve as a reservoir of antibiotic resistant pathogen through transfer of resistant plasmid [18]. Many studies on antibiotic resistance in pseudomonads had been carried out using strains of clinical origin [19]. This study selected 22 MDR Pseudomonas from drinking water distribution systems from southwestern Nigeria. These selected MDR strains showed high resistant to amoxillin/clavulanic acid (81.8 %), sulfamethoxazole (77.3 %) and sulfamethoxazole/trimethoprim (72.7 %). Resistant to amoxillin/clavulanic acid is a little similar to the report of Mezue et al. [20] among Pseudomonas from urinary tract infection from Nigeria who reported 100 % resistant to the antibiotics in their studies. Moderate resistant to florfenicol (63.6 %), tetracycline (59.1 %), streptomycin (54.6 %) and ceftiofur (59.1 %) was observed among these Pseudomonads. The tetracycline resistance obtained in our study is similar to what Akinpelu et al. [21] reported among Pseudomonas from another river in Nigeria. The author reported 50 % resistant to tetracycline among their pseudomonads while higher (100 %) resistant to streptomycin compare to what we obtained from the isolates in this study.

Molecular characterization of the antibiotic resistance gene showed high prevalence of tet(A) (31.8 %), sul2 (27.8 %), bla TEM (40.9) for tetracycline, sulfa drug and β-lactamase antibiotic resistance, respectively. There appears to be few studies on the molecular characterization of these genes among Nigeria environmental pseudomonads, therefore, making it difficult to compare with studies from Nigeria. However, among few of the studies, Chikwendu et al. [22] reported the presence of bla SHV and bla TEM among environmental pseudomonads from Nigeria while Odumosu et al. [23] reported bla oxa-10, ampC β-lactamase in 50 and 70 % of Pseudomonas aeruginosa, respectively from Nigeria clinical source. The authors reported that only one of their isolates testing positive for bla SHV and bla CTXM-15. Studies have shown that due to overuse of β-lactam antibiotics, bla TEM and bla SHV enzyme that were originally found in enterobacteriaceae are now found in Pseudomonas [24]. Similarly, the authors also reported that bla SHV enzyme that has been found in Klebsiella, Escherichia and Salmonella can also be found in Pseudomonas. Moreover, in this study we did not detect bla TEM from any of the Pseudomonas studied from these water distribution systems.

We observed 36.36 % of our pseudomonas testing positive for each of aph(3″) c and ant(3″) b which are genes coding for enzymes that modifies aminoglycoside antibiotics. Odumosu et al. [23] also reported the presence of aminoglycoside modifying enzyme (AME) genes which include aac(6′)-I and ant(2″)-I in 50 and 45 %, respectively of their isolates from Nigeria clinical Pseudomonas. Publications on AME genes among Nigeria environmental Pseudomonas spp are also scarce. This could be the first time these genes will be described among pseudomonad from Nigeria environment. However, in Africa, Ndegwa et al. [25] reported the presence of AME in E. coli, klebsiella, Pseudomonas and Acinetobacter from clinical isolates from Kenya. Though in this study, at least one of the AME genes occurred in at least one of these environmental bacteria. It has been reported that the incidence of streptomycin resistance in pathogenic and commensal bacteria in clinical and agricultural habitats is often high. This is most likely caused by the use of streptomycin in these environments [26]. We observed aph (3″) c and ant (3″) to be more frequently detected in this study than aph (6)1d d . This is similar to the study of van Overbeek et al. [27] among bacterial populations in European habitat. The authors reported that out of 22 bacteria isolates whose genomic DNA was extracted and amplified for streptomycin resistance gene, aph (3″) c was the highest occurred, showing its presence in 17 isolates, followed by ant (3″) and aph (6)-1d (both present in 13 isolates), whereas the incidence of aph (6)-1c and ant (6) genes was lowest (present in one and zero isolates, respectively). Occurrence of one bacteria carrying more than one of streptomycin resistance genes was observed in this study. This is also similar to the report of van Overbeek et al. [27].

Similarly, tetracycline resistance gene has also not been described in among Pseudomonads from Nigeria. Although our recent report [28] stated the occurrence of tet(E), tet(M), tet(30) among Alcaligenes, tet(E) in Aeromonas and Klebsiella, tet(B) in Bacillus and Leucobacter from these water distribution systems. Absence of tet(B) but highest occurrence of tet(A) which are both efflux pump genes in these pseudomonads is contrary to the report of Shababi et al. [29] who reported more prevalence of tet(B) than tet(A) in their studies among MDR P. aeruginosa from municipal sewage. However, a study had shown that tet(A) has a broad host range and is often carried by various environmental genera [4]. None of the isolates showed the presence of tetracycline resistance gene [tet(O) and tet(M)] that cause resistant by producing protein that modifies the ribosome.

Occurrence of class 1 integron among these bacteria showed their potential ability to shuttle antibiotic resistance between different bacteria species. This is because integrons are mobile DNA element with the ability to integrate and express gene cassettes by site-specific recombination [30, 31]. Integrase sequence can insert many cassettes coding for different antibiotic resistance, therefore, making a single bacterium possessing it to be resistant to multiple antibiotics. Therefore, emergence of these MDR bacteria with class 1 integron could lead to reduce antibiotic treatment option which could result to an increase possibility of treatment failure, if they infect user of these water. In fact, most of the genes like aminoglycoside resistance, β-lactam resistance and sulpha-drug resistance have been reported as gene cassettes in association with class 1 integron [32]. Five of these pseudomonads were observed to test positive for the variable region of this class 1 integron. This implies the insertion of antibiotic resistant cassette in the integrase sequence and these resistance gene cassettes include aminoglycosides (aadA2, aadA1), trimethoprim (dfrA15, dfr7) and sulphonamide (sul1) resistance.

The size of plasmids observed from our study contradicts previous studies from Nigeria [6, 33] which reported low molecular weight plasmids (<2 kb) among bacteria from clinical isolates of P. aeroginosa. The relationship between plasmid profiles and MDR patterns observed in this study suggests that plasmids may have great role to play in the multidrug resistance of the Pseudomonas. Plasmids usually evolve as an integral part of the bacterial genome, consisting of several extra-chromosomal traits, one of which is their resistance genes, which can be exchanged among bacteria of different origins by conjugation [34]. Global dissemination of multiple antibiotic resistance and virulence traits by plasmids also poses an increasing threat to the successful treatment of bacterial infectious diseases in animals and humans alike [35]. Therefore, water sample containing these bacteria may be a source of transfer of antibiotic resistance genes to pathogenic bacteria of human, animal and environmental health significance.

Conclusion

In summary, the occurrence of MDR Pseudomonas harbouring various antibiotic resistance genes, class 1 integron and plasmid in drinking water systems signify that these environmental pseudomonads could significantly contribute to wide-scale transfer of resistance genes in these environments thereby posing health hazard to man and animals that depend on these water sources. This could play a major role in the epidemiology of antibiotic resistance in Nigeria and could also be responsible for prolong treatment of bacterial infection, the emergence of emerging and re-emerging infectious diseases. We hereby recommend integrated antibiotic resistant surveillance system and holistic one health approach as well as promoting prudent use of antibiotics both in clinical and agriculture settings in order to prevent and control multidrug resistant bacteria in southwestern Nigeria.

Declarations

Authors’ contributions

ATA and AAO planned this study. ATA performed the experiment in conjunction with IOO. ATA wrote the manuscript while IOO and AAO made significant contributions to the manuscript preparation. All authors read and approved the final manuscript.

Acknowledgements

We acknowledge Dr Call Douglas of Paul. G. Allen School of Global Animal Health, Washington State University, USA who allowed the Molecular Characterization of the bacteria isolates to be carried out in his Laboratory and also Lisa Lorfe who supplied the technical knowhow.

Compliance with ethical guidelines

Competing interests The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Biological Sciences, Federal University Dutsin-Ma
(2)
Department of Microbiology, University of Ibadan
(3)
Department of Veterinary Public Health and Preventive Medicine, University of Ibadan
(4)
Paul G. Allen School for Global Animal Health, Washington State University

References

  1. Craun GF, Calderon RL, Craun MF. Outbreaks associated with recreational water in the United States. Int J Environ Health Res. 2005;15:243–62.View ArticlePubMedGoogle Scholar
  2. Pollack M. Principles and practice of infectious diseases, eds. In: Mandell, G. L., Bennet, J. E. and Dolin, R. (Churchill Livingstone, Philadelphia).2000 2: 2310-2335.Google Scholar
  3. Lyczak JB, Cannon CL, Pier GB. Lung infection associated with cystic fibrosis. Clin Microbiol Rev. 2002;15:194–222.View ArticlePubMed CentralPubMedGoogle Scholar
  4. Zhang XX, Zhang T, Fang HHP. Antibiotic resistance genes in water environment. Appl Microbiol Biotechnol. 2009;82:397–414.View ArticlePubMedGoogle Scholar
  5. Bonomo RA, Szabo D. Mechanisms of multidrug resistance in Acinetobacter species and Pseudomonas aeruginosa. Clin Infect Dis. 2006;43:49–56.View ArticleGoogle Scholar
  6. Yah SC, Eghafona NO, Enabulele IO. Prevalence of plasmids mediated Pseudomonas aeruginosa resistant genes from burn wound patients at the university of Benin teaching hospital Benin City. Nigeria J Biomed Sci. 2006;5:61–8.Google Scholar
  7. Chen J, Su Z, Liu Y, Wang S, Dai X, Li Y, Peng S, Shao Q, Zhang H, Wen P, Yu J, Huang X, Xu H. Identification and characterization of class 1 integrons among Pseudomonas aeruginosa isolates from patients in Zhenjiang, China. Int J Infect Dis. 2009;13:717–21.View ArticlePubMedGoogle Scholar
  8. Ruiz-Martínez L, López-Jiménez L, Fusté E, Vinuesa T, Martínez JP, Viñas M. Class integrons in environmental and clinical isolates of Pseudomonas aeruginosa. Int J Antimicrob Agents. 2011;38:398–402.View ArticlePubMedGoogle Scholar
  9. Adesoji AT, Ogunjobi AA. Occurrence of multidrug-resistant bacteria in selected water distribution systems in Oyo State, Nigeria. Glob Vet. 2013;11:214–24.Google Scholar
  10. Adesoji AT, Ogunjobi AA. Physicochemical properties and occurrence of antibiotic-resistant bacteria in Ife and Ede water distribution systems of southwestern Nigeria. World Appl Sci J. 2013;27:1098–110.Google Scholar
  11. Adesoji AT, Ogunjobi AA, Olatoye IO. Drinking water distribution systems of dams in Ondo state, Nigeria as reservoir of multi-drug resistant bacteria. World Appl Sci J. 2014;32:403–14.Google Scholar
  12. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 2007;25:3389–402. http://www.ncbi.nlm.nih.gov/BLAST.
  13. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–80.View ArticlePubMed CentralPubMedGoogle Scholar
  14. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Bio Evol. 1987;4:406–25.Google Scholar
  15. Kumar S, Tamura K, Nei M. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 2004;5:150–63.View ArticlePubMedGoogle Scholar
  16. CLSI (Clinical and Laboratory Standards Institute) Performance standards for antimicrobial susceptibility testing: 15th informational supplement M100-S15. Wayne: CLSI; 2005.Google Scholar
  17. Pollack M. Pseudomonas aeruginosa. In: Mandell GL, Dolan R, Bennett JE, editors. Principles and practices of infectious diseases. New York: Churchill Livingstone; 1995. p. 1820–2003.Google Scholar
  18. Baquero F, Martínez JL, Cantó N. Antibiotics and antibiotic resistance in water environments. Curr Opin Biotechnol. 2008;19:260–5.View ArticlePubMedGoogle Scholar
  19. Ndip RN, Dilonga HM, Ndip LM, Akoachere JF, Nkuo Akenji T. Pseudomonas aeruginosa isolates recovered from clinical and environmental samples in Buea, Cameroon: current status on biotyping and antibiogram. Trop Med Int Health. 2005;10:74–81.View ArticlePubMedGoogle Scholar
  20. Mezue K, Ofong C, Nmezi D, Ugochukwu-Obi G. Antibiotic Sensitivity patterns in urinary tract infection at Tertiary Hospital. Medikka J Univ Nigeria Med Stud. 2006. Available on http://www.medikkajournal.com/UTI.htm. Extracted on 7/01/2015.
  21. Akinpelu AT, Akinloye OM, Olukemi BC, Adegoke AE, Olayinka S. Antibiotic resistant pattern of isolated bacteria from Obere River in Orile-Igbon, Oyo State Nigeria. Afr J Microbiol Res. 2014;8:1318–21.View ArticleGoogle Scholar
  22. Chikwendu CI, Ibe SN, Okpokwasili GC. Detection of bla SHV and bla TEM beta-lactamase genes in multi-resistant Pseudomonas isolates from environmental sources. Afr J Microbiol Res. 2011;5:2067–74.View ArticleGoogle Scholar
  23. Odumosu BT, Adeniyi BA, Chandra R. Analysis of integrons and associated gene cassettes in clinical isolates of multidrug resistant Pseudomonas aeruginosa from Southwest Nigeria. Ann Clin Microbiol Antimicrob. 2013;12:29–35.View ArticlePubMed CentralPubMedGoogle Scholar
  24. Bradford PA. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev. 2001;14:933–51.View ArticlePubMed CentralPubMedGoogle Scholar
  25. Ndegwa DW, Budambula NLM, Kariuki G, Kiiru JN. Aminoglycoside modifying enzymes detected in strains of Escherichia, Klebsiella, Pseudomonas and Acinetobacter implicated in invasive infections in Nairobi, Kenya. In: Proceedings of 2010 JKUAT scientific technological and industrialization conference Centre for Microbiology. Nairobi, Kenya: Kenya Medical Research Institute; 2010.Google Scholar
  26. Seveno NA, Kallifidas D, Smalla K, van Elsas JD, Collard JM, Karagouni AD, Wellington EMH. Occurrence of reservoirs of antibiotic resistance genes in the environment. Rev Med Microbiol. 2002;13:15–27.View ArticleGoogle Scholar
  27. van Overbeek LSV, Wellington EMH, Egan S, Smalla K, Heuer H, Collard JM, Guillaume G, Karagouni AD, Nikolakopoulou TL, Elsas JDVE. Prevalence of streptomycin-resistance genes in bacterial populations in European habitats. FEMS Microbiol Ecol. 2001;42:277–88.View ArticleGoogle Scholar
  28. Adesoji AT, Ogunjobi AA, Olatoye IO, Call DR. Prevalence of tetracycline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria. Ann Clin Microbiol Antimicrob. 2015;14:35. doi:https://doi.org/10.1186/s12941-015-0093-1.View ArticlePubMed CentralPubMedGoogle Scholar
  29. Shehabi AA, Haider AA, Fayyad MK. Frequency of antimicrobial resistance markers among Pseudomonas aeruginosa and Escherichia coli isolates from municipal sewage effluent water and patients in Jordan. Int Arabic J Antimicrob Agents. 2011;1:1–5.Google Scholar
  30. Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiol. 2006;4:608–20.View ArticlePubMedGoogle Scholar
  31. Rowe-Magnus DA, Mazel D. The role of integrons in antibiotic resistance gene capture. Int J Med Microbiol. 2002;292:115–25.View ArticlePubMedGoogle Scholar
  32. Poonsuk K, Tribuddharat C, Chuanchuen R. Class 1 integrons in Pseudomonas aeruginosa and Acinetobacter baumannii isolated from clinical isolates. Southeast Asian J Trop Med Public Health. 2012;43:376–84.PubMedGoogle Scholar
  33. Olayinka AT, Onile BA, Olayinka BO. Prevalence of multi-drug resistant (MDR) Pseudomonas aeruginosa isolates in surgical units of Ahmadu Bello University Teaching Hospital, Zaria, Nigeria: an indication for effective control measures. Afr Med. 2004;3:13–6.Google Scholar
  34. Carattoli A. Plasmids in Gram negatives: molecular typing of resistance plasmids. Int J Med Microbiol. 2011;301:654–8.View ArticlePubMedGoogle Scholar
  35. Bush K. Bench-to-bedside review: the role of beta-lactamases in antibiotic-resistant Gram-negative infections. Crit Care. 2010;14:224.View ArticlePubMed CentralPubMedGoogle Scholar
  36. Baker GC, Smith JJ, Cowan DA. Review and reanalysis of domain-specific 16S primers. J Microbiol Methods. 2003;55:541–55.View ArticlePubMedGoogle Scholar
  37. Muyzer G, de Waal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol. 1993;59:695–700.PubMed CentralPubMedGoogle Scholar
  38. Houang AT, Chu YW, Lo WS, Chu KY, Cheng AF. Epidemiology of rifampin ADP-ribosyltransferase (arr-2) and metallo-b-lactamase (bla IMP-4 ) gene cassettes in class 1 integrons in Acinetobacter strains isolated from blood cultures in 1997 to 2000. Antimicrob Agents Chemother. 2003;47:1382–90.View ArticlePubMed CentralPubMedGoogle Scholar
  39. Roe MT, Vega E, Pillai SD. Antimicrobial resistance markers of Class 1 and Class 2 integron bearing Escherichia coli from irrigation water and sediments. Emerg Infect Dis. 2003;9:822–6.View ArticlePubMed CentralPubMedGoogle Scholar
  40. Hall RM, Collis CM. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol Microbiol. 1995;15:593–600.View ArticlePubMedGoogle Scholar
  41. White PA, Mciver CJ, Rawlinson WD. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother. 2001;45:2658–61.View ArticlePubMed CentralPubMedGoogle Scholar
  42. Vinue L, Saenz Y, Rojo-Bezares B, Olarte I, Undabeitia E, Somalo S, Zarazaga M, Torres C. Genetic environment of sul genes and characterisation of integrons in Escherichia coli isolates of blood origin in a Spanish hospital. Int J Antimicrob Agents. 2010;35:492–6.View ArticlePubMedGoogle Scholar
  43. Stokes HW, Hall RM. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol Microbiol. 1989;3:1669–83.View ArticlePubMedGoogle Scholar
  44. Sundstrom L. The potential of integrons and connected programmed rearrangements for mediating horizontal gene transfer. APMIS. 1998;84:37–42.View ArticleGoogle Scholar
  45. Call DR, Brockman FJ, Chandler DP. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays. Int J Food Microbiol. 2003;67:71–80.View ArticleGoogle Scholar
  46. Henriques IS, Fonseca F, Alves A, Saavedra MJ, Correia A. Occurrence and diversity of integrons and β-lactamase genes among ampicillin-resistant isolates from estuarine waters. Res Microbiol. 2006;157:938–47.View ArticlePubMedGoogle Scholar

Copyright

© Adesoji et al. 2015

Advertisement