Open Access

Prevalence of tetracycline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria

  • Ayodele. T. Adesoji1Email author,
  • Adeniyi. A. Ogunjobi2,
  • Isaac. O. Olatoye3, 4 and
  • Douglas. R. Douglas4, 5
Annals of Clinical Microbiology and Antimicrobials201514:35

https://doi.org/10.1186/s12941-015-0093-1

Received: 26 February 2015

Accepted: 17 June 2015

Published: 25 June 2015

The Erratum to this article has been published in Annals of Clinical Microbiology and Antimicrobials 2015 14:41

Abstract

Background

Antibiotic resistance genes [ARGs] in aquatic systems have drawn increasing attention they could be transferred horizontally to pathogenic bacteria. Water treatment plants (WTPs) are intended to provide quality and widely available water to the local populace they serve. However, WTPs in developing countries may not be dependable for clean water and they could serve as points of dissemination for antibiotic resistant bacteria. Only a few studies have investigated the occurrence of ARGs among these bacteria including tetracycline resistance genes in water distribution systems in Nigeria.

Methodology

Multi-drug resistant (MDR) bacteria, including resistance to tetracycline, were isolated from treated and untreated water distribution systems in southwest Nigeria. MDR bacteria were resistant to >3 classes of antibiotics based on break-point assays. Isolates were characterized using partial 16S rDNA sequencing and PCR assays for six tetracycline-resistance genes. Plasmid conjugation was evaluated using E. coli strain DH5α as the recipient strain.

Results

Out of the 105 bacteria, 85 (81 %) and 20 (19 %) were Gram- negative or Gram- positive, respectively. Twenty-nine isolates carried at least one of the targeted tetracycline resistance genes including strains of Aeromonas, Alcaligenes, Bacillus, Klebsiella, Leucobacter, Morganella, Proteus and a sequence matching a previously uncultured bacteria. Tet(A) was the most prevalent (16/29) followed by tet(E) (4/29) and tet30 (2/29). Tet(O) was not detected in any of the isolates. Tet(A) was mostly found with Alcaligenes strains (9/10) and a combination of more than one resistance gene was observed only amongst Alcaligenes strains [tet(A) + tet30 (2/10), tet(A) + tet(E) (3/10), tet(E) + tet(M) (1/10), tet(E) + tet30 (1/10)]. Tet(A) was transferred by conjugation for five Alcaligenes and two E. coli isolates.

Conclusions

This study found a high prevalence of plasmid-encoded tet(A) among Alcaligenes isolates, raising the possibility that this strain could shuttle resistance plasmids to pathogenic bacteria.

Keywords

Tetracycline resistanceMultidrug resistanceWater treatment16S rDNA library

Introduction

Tetracycline antibiotics have been used to treat infectious diseases for more than half a century [1]; they have also been used nearly as long to promote growth in food animal production systems [24]. Growth-promoting properties of tetracyclines were first described in 1949 for chickens fed chlortetracycline supplemented feed [5]. Subsequently, they were widely applied in animal husbandry thanks to improving the growth rate to feed intake ratio [68].

Tetracycline inhibits bacterial growth by interfering with protein synthesis when the antibiotic binds to the 30S ribosomal subunit thereby preventing aminoacyl-t-RNA binding to the ribosomal A site and preventing synthesis of polypeptides [1]. Resistance to tetracycline is usually conferred through acquisition of resistance genes associated with mobile genetic elements [9]. These genes could be disseminated by interspecies transfer mediated by plasmids, transposons, and bacteriophage [10, 11]. Once resistance genes are introduced into the environment, they are also exposed to selective pressure, such as antibiotics produced by indigenous antibiotic producers in soil. However, selection can occur in the environment without antibiotic selective pressure [12]. For example, Gilliver et al. [13] reported that antibiotic-resistant bacteria were found in wild rodents that had never been exposed to antibiotics. Therefore, antibiotic resistance genes might be distributed and preserved in the broader environment with or without antibiotic selective pressure. Four resistance mechanisms have been described, including protection of the ribosome by a large cytoplasmic protein, energy-dependent efflux, enzymatic inactivation and target modification [14, 15].

Several investigators have reported findings for antibiotic resistant bacteria found in finished drinking water based on culture-dependent methods [16], indicator organisms [17] and qualitative and quantitative molecular techniques [18, 19, 16]. Studies have demonstrated that the susceptibility of antibiotic resistant bacteria to a disinfectant and the susceptibility of antibiotic-susceptible bacteria to a disinfectant can be genetically linked [20, 21] and thus co-selection can occur with disinfectant exposure. Armstrong et al. [22, 23] suggested that stress-tolerant bacteria selected by chlorination might be more antibiotic resistant, and one study found that suboptimal chlorine treatment of drinking water selected for multidrug-resistant Pseudomonas aeruginosa [24]. Xi et al. [16] reported an increased prevalence of antibiotic resistance genes and specialized groups of antibiotic resistant bacteria in tap water compared to source water and they, suggested that water treatment could differentially favor the antibiotic resistant bacteria and/or induce transfer of antibiotic resistance genes among subsets of the bacterial population. Figueira et al. [25] studied different populations of waste water E. coli and concluded that variations on the prevalence of quinolone resistance were correlated with the dynamics of some population sub-sets. Vaz-Moreira et al. [26] characterized patterns of antimicrobial resistance for sphingomonads isolated from tap water and cup fillers of dental chairs. They also concluded that antibiotic resistance patterns are often species- rather than site-related. There is a paucity of information on the prevalence of tetracycline resistance genes among bacteria isolates from treated and untreated water in Nigeria. The goal of this study was to estimate the prevalence of select tetracycline resistance genes among bacteria from isolated water distribution systems in south-west Nigeria.

Materials and methods

Site description

Samples were collected from water treatment plants (WTPs) that employ conventional methodologies for water purification including filtration, flocculation, sedimentation and disinfection. The Ife dam is the smallest (0.95 km2) and is located at Obafemi Awolowo University Ile-Ife, Osun State. The Ede Erinle dam is located in Ede, Osun State and extends approximately 14.0 km2 at the normal water level. The Eleyele dam (1.5 km2) services the Ibadan metropolis in Oyo State Nigeria. The Asejire dam (7.5 km2) is located in Asejire, approximately 30 km east of Ibadan. The Owena-Ondo dam (7.8 km2) is located near Akure town, Ondo State. The Owena-Ijesha dam (1.7 km2) is located near Ilesha, in Osun State. More details about each of these sample sites can be found elsewhere [2729].

Sample collection, bacteria isolation and characterization

Water samples were collected into sterile bottles from raw, treated and municipal taps at each WTPs. Samples were collected four times during a seven month period (December, 2010 to July, 2011). Samples were serially diluted and plated on Nutrient agar, Eosin Methylene blue agar (EMB) and Deoxycholate agar (DCA). Afterwards, bacteria were picked with the goal of maximizing the diversity of colony morphology represented from each sample. Picked colonies were re-streaked on Nutrient agar to obtain pure cultures. These were subsequently transferred to Nutrient agar slants and also stored in phosphate buffer glycerol at −80 °C.

Identification of bacteria using 16S rDNA sequencing

Total genomic DNA was prepared from isolates after overnight culture in Luria Betani (LB) agar. A sample of culture was selected using a sterile plastic loop and re-suspended in 200 μl of 5 % Chelex 100 (BioRad) in a microcentifuge tube. The suspensions were boiled for 10 min, followed by centrifugation for 1 min (14, 000 ×g). A fragment of the 16S rDNA sequence was amplified using primer 16 s-8 F (AGAGTTTGATCMTGGCTCAG) and 16 s-517R (ATTACCGCGGCTGCTGG) [30, 31]. Extracted DNA supernatant (5 μl) was used as template with 2 mM MgCl2, 0.8 mM dNTPs, 0.2 μM of each primer and 1X PCR buffer. Reaction conditions included 1 min denaturation (95 °C) followed by 30 cycles of 96 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s and a final extension of 72 °C for 10 min. PCR products were separated and visualized by gel electrophoresis (1 %) to confirm amplification. PCR products were sequenced using Big Dye Terminator chemistry (Eurofins MWG, USA) and manual base calls and sequence trimming was completed using Sequencher 5.0 (Gene Codes Corporation, Ann Arbor, MI) BLASTn [32] was used to identify the best matches from Genbank based on percent sequence identity.

Antibiotic susceptibility testing

The antibiotic resistance profile of the bacteria was determined using breakpoint assays on LB Agar plates. Agar was autoclaved, cooled to 55 °C and antibiotics were added to specific breakpoint concentration (Table 1) before agar was poured into petri dishes (150 × 15 mm). Bacteria were retrieved from freezer stocks and transferred from 96-well plates into another 96-well plate with sterile LB broth using a pin replicator and incubated overnight at 37 °C. Cultured isolates were then re-transferred onto LB plates with the antibiotics and incubated over night at 37 °C. Isolates were scored as “1” for growth (resistant) or “0” for no growth (susceptible) for each antibiotic plate. A no-antibiotic plate was used to confirm successful transfer of culture to agar plates using the 96-well replicator. Isolates of bacteria that were resistant to >3 classes of antibiotics were considered MDR. Proportions of resistant bacteria were calculated and 95 % confidence intervals were estimated based on the formula 1.96*sqrt[(p*(1-p))/n] where p = proportion resistant and n = number of isolates resistant to a given antibiotic.
Table 1

Antibiotic concentrations tested against Gram-positive and Gram-negative bacteria

Antibiotics for gram negative with concentration (μg/ml)

Antibiotics for gram positive with concentration (μg/ml)

Code

Name

Concentration

Code

Name

Concentration

FF

Florfenicol

16

SU

Sulfamethoxazole

512

T

Tetracycline

16

AM

Ampicillin

0.5

S

Streptomycin

16

T

Tetracycline

16

G

Gentamycin

16

SXT

Sulfamethoxazole/Trimethoprim

76/4

K

Kanamycin

64

G

Gentamycin

16

C

Chloramphenicol

32

E

Erythromycin

8

N

Nalidixic Acid

30

RIF

Rifampin

4

AMC

Amoxillin/Clavulanic Acid

32/16

LIN

Lincomycin

4

CEF

Ceftiofur

12

CIP

Ciprofloxacin

4

SU

Sulfamethoxazole

512

   

SXT

Sulfamethoxazole/Trimethoprim

76/4

   

Genotyping of tetracycline resistance genes

The diversity of tetracycline resistant genes encoded in the genome of 105 tetracycline and multidrug resistant isolates was assessed by testing for the presence of tetracycline resistance genes that encode resistant by efflux pump mechanism [tet(A), tet(B), tet(E), tet30] and genes that encode ribosomal protection proteins [tet(M) and tet(O)] (Table 2). PCR amplification reactions included 5 μl of the Chelex extracted DNA as template. The PCR reaction mixture followed the same protocol as described for 16S rDNA PCR with the exception of different primer annealing temperature (Table 2).
Table 2

Primers used in this study for amplification of tetracycline-resistance genes (Call et al., 2003)

Primer pair

Target

Sequence (5′-3′)

Annealing temperature (°C)

Amplicon size (bp)

Reference

tet(A)- F

tet(A)

TTGGCATTCTGCATTCACTC

60

494

Call et al., 2003

tet(A)- R

 

GTATAGCTTGCCGGAAGTCG

60

494

,,

tet(B)- F

tet(B)

CAGTGCTGTTGTTGTCATTAA

60

571

,,

tet(B)- R

 

GCTTGGAATACTGAGTGTAA

60

571

 

tet(E)- F

tet(E)

TATTAACGGGCTGGCATTTC

55

544

,,

tet(E)- R

 

AGCTGTCAGGTGGGTCAAAC

55

544

,,

tet(M)- F

tet(M)

ACACGCCAGGACATATGGAT

55

536

,,

tet(M)- R

 

ATTTCCGCAAAGTTCAGACG

55

536

,,

tet(30)- F

tet(30)

CCGTCATGCAATTTGTGTTC

55

550

,,

tet(30)- R

 

TAGAGCACCCAGATCGTTCC

55

550

,,

Tet(O)-F

tet(O)

GCGGTAATTATGGGAAACGA

55

550

,,

Tet(O)-R

 

TTTCCCGCTGTTCAGATTTC

   

Conjugation experiments

A nalidixic acid resistant strain of E. coli (DH5α) was used as a recipient for conjugation experiments. A subset of isolates (n = 19) was selected as donor strains because they harboured a diversity of tetracycline resistance genes (tet (A), tet (B) and tet 30) while being sensitive to nalidixic acid. Overnight cultures were prepared in LB broth. Nitrocellulose membrane papers were cut (2 × 1 cm) and were sterilized by using a dry cycle autoclave at 121 °C for 30 min. The sterile filters were placed aseptically on the surface of solidified sterile LB agar. Overnight broth cultures (10 μl) of both the donor and recipient bacteria were spotted together onto a filter paper and were incubated overnight at 37 °C. Thereafter, 500 μl of sterile phosphate buffer saline was used to wash the bacteria from the nitrocellulose paper into a sterile petri dish. A micropipette was used to transfer the fluid on to the surface of LB agar plate containing 20 μl/ml of nalidixic acid and 16 μl/ml of tetracycline followed by overnight incubation. When bacteria grew under this condition they were considered successful conjugants. DNA was extracted from representative isolates using Chelex method (described above) and used in the PCR amplification of the transferred genes for genotypic confirmation.

Results and discussion

Details on the physicochemical, microbial quality and antibiogram based on sample location of each of these water distribution systems have been reported elsewhere [2729]. Herein we report findings for a total of 105 multi-drug resistant (MDR) bacteria that included strains with resistance to tetracycline that were selected for genotyping. Eighty-two (80.95 %) and 23 (19.04 %) of isolates were Gram-negative and Gram-positive, respectively. We could discern no outstanding differences between sample sites that might contribute to the variance within and between these locations. For Gram-positive bacteria resistance was detected for all antibiotics tested except ciprofloxacin (Fig. 1) whereas resistant isolates were detected for all antibiotics tested for Gram-negative bacteria (Fig. 2). The absence of ciprofloxacin resistance for the Gram-positive isolates might reflect a relatively low-level of use in Nigeria [33] or we may have adopted a breakpoint concentration that was too high to detect variation in resistance levels.
Fig 1

Prevalence of antibiotic resistant Gram-positive bacteria from all sampled water (+95 % confidence intervals). Codes: Ampicillin (AM); Gentamycin (GEN); Sulfamethoxazole (SU); Sulfamethoxazole/ Trimethoprim (SXT); Erythromycin (E); Riframprim (RIF); Lincomycin (LIN); Ciprofloxacin (CIP)

Fig 2

Prevalence of antibiotic resistant Gram-negative bacteria from all sampled water (+95 % confidence intervals). Codes: Ceftiofur (CEF); Chloramphenicol (C); Florfenicol (FF); Kanamycin (K), Streptomycin (S) and Gentamycin (GEN); Nalidixic Acid (N); Sulfamethoxazole (SU); Sulfamethoxazole/ Trimethoprim (SXT); Amoxicillin/Clavulanic Acid (AMC)

Twenty nine isolates from all sample locations possessed tetracycline-resistance genes with tet(A) being the most prevalent (Table 3). The two bacteria carrying tet30 were isolated from the Ede finished water and Owena-Idanre municipal tap water. 16SrDNA sequencing indicated that these two bacteria were members of the Alcaligenes genera (Table 4). This may be the first report of tet30 in this genera indicating that this gene can be found among a wide diversity of bacteria [9].
Table 3

Summary of total numbers of isolates collected per sample during the study and number positive for each tet genotype

Sample site

No + ve for at least one tet gene

tet(A)

tet(B)

tet(E)

tet(M)

tet30

Total

Ife, Dam 1

 

 Raw water

2

1

0

1

0

0

5

 Finished water

3

1

0

1

1

0

7

 Tap water

0

0

0

0

0

0

2

 Tap water

0

0

0

0

0

0

0

Ede, Dam 2

 

 Raw water

1

0

1

0

0

0

5

 Finished water

2

2

0

0

0

1

3

 Tap water

0

0

0

0

0

0

0

 Tap water

0

0

0

0

0

0

1

Asejire Dam 3

 

 Raw water

3

1

2

ND

ND

ND

7

 Finished water

0

0

0

0

0

0

6

 Tap water

1

0

1

0

0

0

3

 Tap water

0

0

0

0

0

0

1

Eleyele Dam 4

 

 Raw water

1

0

0

0

1

0

11

 Finished water

0

0

0

0

0

0

0

 Tap water

1

0

0

1

0

0

1

 Tap water

0

0

0

0

0

0

0

Owena-Ondo Dam 5

 

 Raw water

0

0

0

0

0

0

0

 Finished water

3

3

0

0

0

0

5

 Tap water

1

1

0

0

0

0

6

 Tap water

3

3

0

0

0

0

7

 Tap water

1

0

0

0

1

0

8

Owena-Ijesha Dam 6

 Raw water

3

1

0

2

2

0

17

 Finished water

0

0

0

0

0

0

1

 Tap water

2

1

0

1

0

0

5

 Tap water

2

2

0

2

0

1

4

 Total

29

16

4

8

5

2

105

Table 4

Summary of prevalence and total number of tetracycline-resistant bacteria species and genotypes

Bacteria

No of MDR isolates genotyped

No. (%) tetracycline resistant

Source of Isolate

tet genotype

No Positive for tet gene

Aeromonas spp

5

1 (3.44)

IRW

tet(E)

1

Alcaligenes spp

20

10 (34.48)

IFW, EDFW, OWODFW,OWODM2, OWIRW, OWIM1, OWIM2

tet(A)

9

tet(E)

4

tet(M)

1

tet30

2

tet(A) + tet30

2

tet(A) + tet(E)

3

tet(A) + tet(M)

1

tet(E) + tet(M)

1

tet(E) + tet30

1

tet(A) + tet(E) + tet30

1

tet(A) + tet(E) + tet(M)

1

tet(A) + tet(E) + tet(M)

1

Bacillus spp

45

2 (6.89)

IFW, EDRW

tet(B)

1

tet(E)

1

Klebsiella spp

14

1 (3.44)

OWIRW

tet(E)

1

Leucobacter spp

2

1(3.44)

ARW

tet(B)

1

Morganella spp

7

6 (20.69)

EDFW, ERW, OWODFW, OWODM1, OWODM3, OWIRW

tet(A) + tet(M)

3

 

3

Proteus spp

22

2 (6.90)

ARW, EFW

tet(A)

1

tet(B)

1

Uncultured bacteria clone

7

3 (10.34)

ARW, AM1

tet(B) + tet(M)

2

 

1

Codes: IRW = Ife raw water, IFFW = Ife treated water, IFM1 and IFM2 = Ife municipal tap 1 and 2, EDRW = Ede raw water, EDFW = Ede treated water, EDM1 and EDM2 = Ede municipal tap 1 and 2, ARW = Asejire raw water, AFW = Asejire treated water, AM1 and AM2 = Asejire municipal tap 1 and 2, ERW = Eleyele raw water, EFW = Eleyele treated water, EM1 and EM2 = Eleyele municipal 1 and 2, OWODRW = Owena Ondo raw water, OWODFW = Owena Ondo treated water, OWODM1 and OWODM2 = Owena-ondo municipal tap 1 and 2, OWIRW = Owena-Idanre raw water, OWIFW = Owena-Idanre treated water, OWIM1 and OWIM2 = Owena-Idanre municipal tap 1 and 2 Note: Bacteria was identified to the genus level by 16S rDNA partial Sequence

Two Gram-positive (Bacillus sp and Leucobacter sp) and three Gram-negative bacteria (1 Proteus and 2 unidentified) harbored tet(B) (Table 4). This gene has been reported previously in Bacillus and Proteus [34] but this may be the first report for detection of tet(B) for the genus Leucobacter. Sequence analysis of the tet (B) gene showed that it was 99 % similar to tet(B) gene found in a Pseudomonas strain (accession no: AB089594.1). We surmise, however, presence of this gene in an unidentified environmental isolate implies that unidentified bacteria from the environment could be a reservoir and source of transfer to other bacteria of antibiotic resistance gene. This is similar to the report of Riesenfeld et al. [35] who also detected antibiotic resistance genes attributable to uncultured or unidentified soil bacteria.

The tet(E) gene was detected amongst a diverse group of genera (Aeromonas, Bacillus, Klebsiella, Leucobacter and Alcaligenes; Table 4). Jacobs and Chenia [36] reported that tet(E) is frequently detected among the Aeromonas in South Africa. Chopra and Roberts [11] reported that tet(E) has been found in combination with tet(B), tet(I), tet(C) tet(D), tet31 in the same bacteria including additional genera (Edwardsiella, Providencia, Proteus, Citrobacter, Shigella). We only found tet(E) in conjunction with tet(M), tet(A) and tet30 in Alcaligenes isolates (Table 4). Other combinations of tetracycline-resistance genes were observed in the current study for the genus Alcaligenes (Table 4) and Alcaligenes was the only genus with >1 tetracycline gene present.

The higher prevalence of tet(A) (Table 4) compared to other tetracycline resistance genes is consistent with other reports [37, 38, 34]. Multiple reports indicate that the presence of these genes among different bacteria including E.coli [39] and Aeromonas [40]. Agerso and Sandvang [41] reported tet(A) for the first time in three isolates of Alcaligenes. Bacteria of the Alcaligene genus have been isolated from intestine of humans and from various hospital or environmental water sources [42]. These strains can produce opportunistic infection, particularly for severely immune-compromised patients including those with neutropenia and malignant tumor or cardiovascular disease [43, 44].

Ribosomal protection protein genes were detected less frequently in this study; we did not detect tet(O) while five bacteria were PCR-positive for tet(M). Another study showed that tet(M) was widely distributed in coastal aquaculture areas and sediments in Mekong River, Vietnam [45]. Tet(M) has been found in a diversity of bacteria including Eikenella, Kingella and Neisseria [11]. We found tet(M) in Alcaligenes, Morganella and an unidentified bacterium. The distribution of tet(M) no well described for bacteria that have less clinical significance.

There are numerous differences between each of the sample sites that preclude drawing associations between the presence of specific resistance genes relative to different WTP practices. It was notable however, that amongst the six water distribution systems, bacteria from Dam 5 (Owena-Ondo) carried the highest proportion of tet(A) (7/16) (Table 3). We also observed that out of 8 bacteria tested positive for tet(E), the highest (5/8) prevalence was among bacteria from Dam 6 (Owena-Ijesha), tet(B) was found among three isolates from the raw water of Asejire and Ede water treatment plants while none of the bacteria isolated from the treated water showed the presence of this gene. Experimental manipulation and controls would be needed to determine if different WTP practices contribute to differences in the distribution of tetracycline resistance genes.

We also tested other tetracycline-resistant MDR bacteria, including strains of Acinetobacter, Aquitalae, Bordetella, Brevundimonas, Chromobacterium, Citrobacter, Camamonas, Enterobacter, Lysinibacillus, Myroides, Pantoae, Providencia, Pseudochrobactrum, Psychrobacter, Serratia, Sphingobacterium, Staphylococcus, Stenotrophomonas, Ralstonia and Trabulsiella but we did not detect any of the tetracycline-resistance genes for which we tested (data not shown). It is likely that these isolates harbor a diversity of other tetracycline-resistance gene; earlier studies identified 23 genes encoding efflux pumps and 11 genes encoding ribosomal protection proteins, not including mosaic tetracycline resistance genes [46], since the first report of transferable tetracycline resistance in 1960 [9]. It is likely that other novel tetracycline-resistance genes can be found in these environments.

Conjugation experiments showed that five of 17 tet(A) positive bacteria successfully transferred the gene to the recipient host using the conditions employed in this study (three Alcaligenes and two E. coli; Table 5). Agerso and Sandvang. [41] demonstrated the transfer of tet (A) from Alcaligenes to E.coli from their studies, results consistent with the tet(A) gene being present on a broad-host plasmid(s) that this is capable of moving between genera. Agerso et al. [47] reported that tet (A) can be located on conjugative plasmids from different incompatibility groups. The one tet30-positive strain of Alcaligenes was able to transfer it to the recipient strain. Among the four bacteria carrying tet(B), only the Proteus could transfer this gene.
Table 5

Bacteria with transferrable tetracycline resistance genes and resistance phenotypes

Strain IDa

Bacteria/ascension nob

Sourcec

Tetracycline resistance gene transferred

Resistance phenotypesd

197

Alcaligenes faecalis JN162124.1

OWODFW

Tet(A)

T, S, K, CEF, AM, SXT, SU

198

Alcaligenes sp. JF707602.1

OWODFW

Tet(A)

T, S, K, AM, SXT, SU

173

Alcaligenes faecalis JN162124.1

OWIRW

Tet(A)

T, S, CEF, SXT, AMC, SU

210A

Escherichia coli CP003034.1

OWODM2

Tet(A)

T, AM, AMC, SU

210B

Escherichia coli CP003034.1

OWODM2

Tet(A)

T, AM, SXT, AMC, SU

46

Proteus vulgaris JN630888.1

ERW

Tet(B)

FF, T, S, G, K, C, AM, SXT, N, AMC, SU

28A

Alcaligenes faecalis HM145896.1

EDFW

Tet30

T, S, G, K, N, CEF, AM, SXT, SU

aThis is our study specific ID designation

bBacteria were identified by 16S rDNA partial sequencing while accenssion number is the Genbank number for the closest match

cFor source of bacteria and code go to Table 3 and footnote of Table 4 respectively

dCodes: Ampicillin (AM); Ceftiofur (CEF); Chloramphenicol (C) and Florfenicol (FF); Kanamycin (K), Streptomycin (S) and Gentamycin (GEN); Tetracycline (T); Nalidixic Acid (N); Sulfamethoxazole (SU); Sulfamethoxazole/ Trimethoprim (SXT); Amoxicillin/Clavulanic Acid (AMC); Erythromycin (E); Riframprim (RIF); Lincomycin (LIN); Ciprofloxacin (CIP)

In summary, we detected transferrable tetracycline- resistance genes among a diversity collection of bacteria, tet(A) was the most common gene detected especially from isolates from the Alcaligenes genus, and horizontal transfer was verified by conjugation experiments. Given these findings it is possible that transfer of these genes occurs regularly in water distribution system. Moreover, Gao et al. [48] noted that antibiotic-resistant bacteria could be introduced into the food chain via aquaculture products and, presumably via washing of food products.

Notes

Declarations

Acknowledgement

We acknowledge the partial support from the Department of Veterinary Microbiology and Pathology and the Paul G. Allen School for Global Animal Health at, Washington State University, Pullman, USA. Lisa Orfe provided invaluable technical support.

Authors’ Affiliations

(1)
Department of Biological Sciences, Federal University Dutsin-Ma
(2)
Department of Microbiology, University of Ibadan
(3)
Department of Veterinary Public Health and Preventive Medicine, University of Ibadan
(4)
Paul G. Allen School for Global Animal Health, Washington State University
(5)
Department of Veterinary Microbiology and Pathology, Washington State University

References

  1. Bryskier A. Tetracyclines. In: Bryskier A, editor. Antimicrobial agents: antibacterials and antifungals. Washington: ASM Press; 2005. p. 642–51.View ArticleGoogle Scholar
  2. Dupont HL, Steele JH. The human health implications of the use of antimicrobial agents in animal feeds. Vet Q. 1987;9:309–20.View ArticlePubMedGoogle Scholar
  3. Schnappinger D, Hillen W. Tetracyclines: antibiotic action, uptake, and resistance mechanisms. Arch Microbiol. 1996;165:359–69.View ArticlePubMedGoogle Scholar
  4. Schwarz S, Roberts MC, Werckenthin C, Pang Y, Lange C. Tetracycline resistance in Staphylococcus spp. from domestic and pet animals. Vet Microbiol. 1998;63:217–28.View ArticlePubMedGoogle Scholar
  5. Stockstad ELR, Jukes TH, Pierce J, Page AC, Franklin AL. The multiple nature of animal protein factor. J Biol Chem. 1949;180:647–54.Google Scholar
  6. IOM (Institute of Medicine) Division of Health Promotion and Disease Prevention). Report of a study: Human health risks with the subtherapeutic use of penicillin or tetracyclines in animal feed. Washington: National Academy Press; 1998.Google Scholar
  7. Anonym. The Use of Drugs in Food Animals, Benefits and Risks. Washington: Committee on Drug Use in Food Animals, National Academy Press; 1999. p. 276.Google Scholar
  8. JETACAR (Joint Expert Advisory Committee on Antibiotic Resistance). The use of antibiotics in food producing animals: antibiotic-resistant bacteria in animals and humans. Canberra: Commonwealth Department of Health and Aged Care and Commonwealth Department of Agriculture, Fisheries and Forestry; 1999. Jolliffe N., Front.Google Scholar
  9. Roberts MC. Update on acquired tetracycline resistance genes. FEMS Microbiology and Letters. 2005;245:195–203.View ArticleGoogle Scholar
  10. Salyers AA, Shoemaker NB, Li LY. In the driver’s seat: the Bacteroides conjugative transposons and the elements they mobilize. J Bacteriol. 1995;177:5727–31.PubMedPubMed CentralGoogle Scholar
  11. Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 2001;65:232–60.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Alonso A. Sa´nchez P, Martı´nez JL: Environmental selection of antibiotic resistance genes. Environ Microbiol. 2001;3:1–9.View ArticlePubMedGoogle Scholar
  13. Gilliver MA, Bennett M, Begon M, Hazel SM, Hart CA. Enterobacteria: antibiotic resistance found in wild rodents. Nature. 1999;401:233–4.View ArticlePubMedGoogle Scholar
  14. Jones CH, Tuckman M, Murphy E, Bradford PA. Identification and sequence of a tet(M) tetracycline resistance determinant homologue in clinical isolates of Escherichia coli. J Bacteriol. 2006;188:7151–64.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Kobayashi T, Suehiro F, Tuyen BC, Suzuki S. Distribution and diversity of tetracycline resistance genes encoding ribosomal protection proteins in Mekong river sediments in Vietnam. FEMS Microbiol Ecol. 2007;59:729–37.View ArticlePubMedGoogle Scholar
  16. Xi C, Zhang Y, Marrs CF, Ye W, Simon C. Prevalence of Antibiotic Resistance in Drinking Water Treatment and Distribution Systems. Appl Environ Microbiol. 2009;75:5714–8.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Scoaris DD, Colacite J, Nakamura CV, Ueda-Nakamura T, de Abreu BA, Dias BP. Virulence and antibiotic susceptibility of Aeromonas spp. isolated from drinking water. Anton Leeuw. Int J Gen Mol Microbiol. 2008;93:111–22.Google Scholar
  18. Figueira V, Vaz-Moreira I, Silva M, Manaia CM. Diversity and antibiotic resistance of Aeromonas spp. in drinking and waste water treatment plants. Water Res. 2011;45:5599–611.View ArticlePubMedGoogle Scholar
  19. Storteboom H, Arabi M, Davis JG, Crimi B, Pruden A. Identification of antibiotic-resistance-gene molecular signatures suitable as tracers of pristine river, urban, and agricultural sources. Environ Sci Tech. 2010;44:1947–53.View ArticleGoogle Scholar
  20. Fraise AP. Susceptibility of antibiotic resistant cocci to biocides. J Appl Microbiol. 2002;92:158–62.View ArticleGoogle Scholar
  21. Rutala WA, Stiegel MM, Sarubbi FA, Weber DJ. Susceptibility of antibiotic-susceptible and antibiotic-resistant hospital bacteria to disinfectants. Infect Control Hosp Epidemiol. 1997;18:417–21.View ArticlePubMedGoogle Scholar
  22. Armstrong JL, Calomiris JJ, Seidler RJ. Selection of antibiotic-resistant standard plate count bacteria during water treatment. Appl Environ Microbiol. 1982;1982(44):308–16.Google Scholar
  23. Armstrong JL, Shigeno DS, Calomiris JJ, Seidler RJ. Antibiotic-resistant bacteria in drinking water. Appl Environ Microbiol. 1981;42:277–83.PubMedPubMed CentralGoogle Scholar
  24. Shrivastava R, Upreti RK, Jain SR, Prasad KN, Seth PK, Chaturvedi UC. Suboptimal chlorine treatment of drinking water leads to selection of multidrug -resistant Pseudom-onas aeruginosa. Ecotoxicol Environ Saf. 2004;58:277–83.View ArticlePubMedGoogle Scholar
  25. Figueira V, Serra E, Manaia CM. Differential patterns of antimicrobial resistance in population subsets of Escherichia coli isolated from waste- and surface waters. Sci Total Environ. 2011;409:1017–23.View ArticlePubMedGoogle Scholar
  26. Vaz-Moreira I, Nunes OC, Manaia CM. Diversity and antibiotic resistance patterns of Sphingomonadaceae isolates from drinking water. Appl Environ Microbiol. 2011;77:5697–706.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Adesoji AT, Ogunjobi AA. Occurrence of Multidrug-Resistant Bacteria in Selected Water Distribution Systems in Oyo State, Nigeria. Global Veterinaria. 2013;11:214–24.Google Scholar
  28. Adesoji AT, Ogunjobi AA, Olatoye IO. Drinking Water Distribution Systems of Dams in Ondo State, Nigeria as Reservoir of Multi-Drug Resistant Bacteria. World Applied Sci J. 2014;32:403–14.Google Scholar
  29. Adesoji AT, Ogunjobi AA. Physicochemical Properties and Occurrence of Antibiotic-Resistant Bacteria in Ife and Ede Water Distribution Systems of Southwestern Nigeria. World Applied Sci J. 2013;27:1098–110.Google Scholar
  30. Shrivastava R, Upreti RK, Jain SR, Prasad KN, Seth PK. Chaturvedi, UC: Suboptimal chlorine treatment of drinking water leads to selection of multidrug-resistant Pseudomonas aeruginosa. Ecol Environ. 2004;58:277–83.Google Scholar
  31. Lye DJ, Dufour AP. A membrane filter procedure for assaying cytotoxic activity in heterotrophic bacteria isolated from drinking water. J Appl Bacteriol. 1991;70:89–94.View ArticlePubMedGoogle Scholar
  32. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–402. www.ncbi.nlm.nih.gov/BLAST.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Yah SC, Yusuf OE, Eghafona N. Pattern of antibiotic usage by adult populations in the city of Benin, Nigeria. Sci Res Essay. 2008;3:081–5.Google Scholar
  34. Rather MA, Aulakh RS, Singh GJP, Mir AQ, Hassan MN. Detection and sequencing of plasmid encoded tetracycline resistance determinants (tetA and tetB) from food-borne Bacillus cereus isolates. Asian Pac J Trop Med. 2012;5:709–12.View ArticlePubMedGoogle Scholar
  35. Riesenfeld CS, Goodman RM, Handelsman J. Uncultured soil bacteria are reservoir of new antibiotic resistance gene. Environ Microbiol. 2004;6:981–9.View ArticlePubMedGoogle Scholar
  36. Jacobs L, Chenia HY. Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture systems. Int J Food Microbiol. 2007;114:295–306.View ArticlePubMedGoogle Scholar
  37. Soge OO, Giardino MA, Ivanova IC, Pearson AL, Meschke JS, Roberts MC. Low prevalence of antibiotic-resistant gram-negative bacteria isolated from rural southwestern Ugandan groundwater. Water SA. 2005;35:343–8.Google Scholar
  38. Henriques IS, Fonseca F, Alves A, Saavedra MJ, Correia A. Occurrence and diversity of integrons and β-lactamase genes among ampicillin-resistant isolates from estuarine waters. Res Microbiol. 2006;157:938–47.View ArticlePubMedGoogle Scholar
  39. Tuckman M, Petersen PJ, Howe AYM, Orlowski M, Mullen S, Chan K, Bradford PA, Jones CH. Occurrence of Tetracycline Resistance Genes among Escherichia coli Isolates from the Phase 3 Clinical Trials for Tigecycline. Antimicrob Agents Chemother. 2007;51:3205–11.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Balassiano IT, Bastos MCF, Madureira DJ, Silva IG, Freitas-Almeida AC, Oliveira SS. The involvement of tetA and tetE tetracycline resistance genes in plasmid and chromosomal resistance of Aeromonas in Brazilian strains. Mem Inst Oswaldo Cruz, Rio de Janeiro. 2007;102:861–6.View ArticleGoogle Scholar
  41. Agersø Y. and Sandvang: Class 1 Integrons and Tetracycline Resistance Genes in Alcaligenes, Arthrobacter, and Pseudomonas spp. Isolated from Pigsties and Manured Soil. Appl Environ Microbiol. 2005;71:7941–7.View ArticlePubMedPubMed CentralGoogle Scholar
  42. Gurdal Y, Kemalettin A, Iftihar K, Rahmet C, Korhan A, Mehmet A. Post-ERCP bacteremia caused by Alcaligenes xylosoxidans in a patient with pancreas cancer. Ann Clin Microbiol Antimicrob. 2006;5:19–24.View ArticleGoogle Scholar
  43. Duggan JM, Goldstein SJ, Chenoweth CE, Kauffman CA, Bradley SF. Achromobacter xylosoxidans bacteremia: report of four cases and review of the literature. Clin Infect Dis. 1996;23:569–76.View ArticlePubMedGoogle Scholar
  44. Aisenberg G, Rolston KV, Safdar A. Bacteremia caused by Achromobacter and Alcaligenes species in 46 patients with cancer (1989–2003). Cancer. 2004;101:2134–40.View ArticlePubMedGoogle Scholar
  45. Suzuki S, Kobayashi T, Suehiro F, Tuyen BC, Tana TS. High occurrence rate of tetracycline (TC)-resistant bacteria and TC resistance genes relates to microbial diversity in sediment of Mekong river main waterway. Microbes Environ. 2008;23:149–52.View ArticlePubMedGoogle Scholar
  46. Patterson AJ, Rincon MT, Flint HJ, Scott KP. Mosaic tetracycline resistance genes are widespread in human and animal fecal samples. Antimicrob Agents Chemother. 2007;51:1115–8.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Agersø Y, Pedersen AG, Aarestrup FM. Identification of Tn5397-like and Tn916-like transposons and diversity of the tetracycline resistance gene tet(M) in enterococci from humans, pigs and poultry. J Antimicrob Chemother. 2006;57:832–9.View ArticlePubMedGoogle Scholar
  48. Gao P, Mao D, Luo Y, Wang L, Xu B, Xu L. Occurrence of sulfonamide and tetracycline-resistant bacteria and resistance genes in aquaculture environment. Water Res. 2012;46:2355–64.View ArticlePubMedGoogle Scholar

Copyright

© Timilehin et al. 2016

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement