Open Access

Transmission and characterization of bla NDM-1 in Enterobacter cloacae at a teaching hospital in Yunnan, China

  • Na Du1,
  • Shumin Liu1,
  • Min Niu1,
  • Yong Duan1,
  • Shuangmeng Zhang1,
  • Jing Yao1,
  • Jian Mao1,
  • Ran Chen1 and
  • Yan Du1Email author
Annals of Clinical Microbiology and Antimicrobials201716:58

https://doi.org/10.1186/s12941-017-0232-y

Received: 20 February 2017

Accepted: 7 August 2017

Published: 22 August 2017

Abstract

Background

In recent years, New Delhi metallo-beta-lactamases 1 (bla NDM-1) has been reported with increasing frequency and become prevalent. The present study was undertaken to investigate the epidemiological dissemination of the bla NDM-1 gene in Enterobacter cloacae isolates at a teaching hospital in Yunnan, China.

Methods

Antimicrobial susceptibility testing was performed using VITEK 2 system and E test gradient strips. The presence of integrons and insertion sequence common region 1 were examined by PCR and sequencing. Clonal relatedness was assessed by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing. Conjugation experiments and Southern blot hybridization were performed to determine the transferability of plasmids.

Results

Ten E. cloacae isolates and their Escherichia coli transconjugants were exhibited similar resistant patterns to carbapenems, cephalosporins and penicillins. 8 (80%) of E. cloacae isolates carried class 1 integron and 1 (12.5%) carried class 2 integron. Integron variable regions harbored the genes which encoded resistance to aminoglycosides (aadA1, aadA2, aadA5, aadB, aac(6′)-Ib-cr), sulfamethoxazole/trimethoprim (dfrA17, dfrA12, dfrA15) and Streptozotocin (sat2). Six E. cloacae isolates belonged to ST74 and exhibited highly similar PFGE patterns. Each isolate shared an identical plasmid with ~33.3 kb size that carried the bla NDM-1 gene, except T3 strain, of which the bla NDM-1 gene was located on a ~50 kb plasmid.

Conclusions

Our findings suggested that plasmid was able to contribute to the dissemination of bla NDM-1. Hence, more attention should be devoted to monitor the dissemination of the bla NDM-1 gene due to its horizontal transfer via plasmid. In addition, nosocomial surveillance system should actively monitor the potential endemic clone of ST74 to prevent their further spread.

Keywords

Enterobacter cloacae NDM-1ST74IntegronISCR1

Background

Enterobacter cloacae is an important nosocomial pathogen, which can cause various infections including urinary tract, skin and soft tissue, respiratory tract, surgical site, biliary tract, sepsis, intravenous catheters, central nervous system and outbreaks at neonatal units [1, 2]. New Delhi metallo-beta-lactamases 1 (bla NDM-1) are Ambler class B Metallo-β-lactamases(MBLs)with carbapenemase activity that confers resistance to all β-lactams except aztreonam, was first identified in a carbapenem-resistant Klebsiella pneumoniae strain recovered from a Swedish patient who was hospitalized in India in 2008 [3], and mainly detected in carbapenem-resistant Acinetobacter spp. in mainland China. However, NDM-1-mediated carbapenem resistance in E. cloacae has been rarely reported in China.

The widespread dissemination of bla NDM-1 is mainly due to plasmids, integrons, insertion sequence common region (ISCR) and clonal outbreaks [4]. Plasmids are extrachromosomal DNA molecules capable of autonomous replication, and can confer resistance to the major antimicrobials [5]. Integrons are bacterial genetic elements able to capture and express genes contained within mobile gene cassettes. Typically, integrons are composed of two conserved regions, a 3′ conserved segment (3′CS) and a 5′ conserved segment (5′CS), as well as an internal variable region containing gene cassettes that encode antimicrobial resistance determinants [6]. ISCR elements can transpose adjacent DNA sequences by a process called rolling-circle replication, now it is recognized as powerful antibiotic resistance gene capture systems and playing a major role in spread of antibiotic resistance genes. However, whether these mobile elements mediate the dissemination of bla NDM-1 gene is still an unsolved mystery in the region. Therefore, the aim of this study is to explore the epidemiological dissemination of the bla NDM-1 gene in E. cloacae isolates at a teaching hospital in Yunnan, China.

Methods

Bacterial strains

In total, ten NDM-1-producing E. cloacae isolates were collected from hospitalized patients in the First Affiliated Hospital of Kunming Medical University between June 2012 and January 2016. All isolates were identified by VITEK2 automated identification system (bioMerieux, France). Carbapenemase activity was assessed by the modified Hodge test, MBL production was examined by imipenem-ethylenediaminetetraacetic acid (EDTA) disk method and the bla NDM-1 gene was determined by PCR in the early stage of the study. All patients were of Yunnan descent and none had a recent history of travelling epidemic area (Table 1).
Table 1

Clinical characteristics of the cases

Isolates

Age (years)

Gender

Specimen

Ward

Average hospital stay (days)

History of travel epidemic area

Outcome

T1

58

Male

Secreta

Orthopedics Department

66

No

Discharge

T2

96

Male

Sputum

General Practice

33

No

Discharge

T3

87

Female

Urine

EICU

117

No

Death

T4

36

Female

Urine

Transplantation Center

20

No

Discharge

T5

32

Male

Urine

Transplantation Center

39

No

Discharge

T6

65

Female

Pleural effusion

EICU

1

No

Death

T7

32

Male

Urine

Transplantation Center

23

No

Discharge

T8

22

Female

Urine

Transplantation Center

35

No

Discharge

T9

11

Female

Blood

NICU

18

No

Discharge

T10

34

Male

Urine

Transplantation Center

32

No

Discharge

EICU emergency intensive care unit, NICU neonatal intensive care unit

Antimicrobial susceptibility testing

Antimicrobial susceptibilities for the NDM-1-producing isolates and transconjugants were initially tested using the VITEK2 system. MICs of imipenem, meropenem and ertapenem were re-evaluated using E test gradient strips (bioMerieux, France) on Mueller–Hinton agar plates and the results interpreted according to the CLSI guidelines [7]. Escherichia coli ATCC 25922 was used as quality control strain.

PCR amplification and sequencing

Isolates were grown overnight in M–H Agar plates at 37 °C and genomic DNA was extracted using boiling method. Class 1, 2, 3 integrons and ISCR1 were, respectively, amplified using the primers intI1/intI1, intI2/intI2, intI3/intI3, hep58/hep59, hep74/hep51, orf513F/orf513R and orf513F/sul1R (Table 2). The amplified PCR products were analyzed by electrophoresis in 2% agarose gels and finally visualized in gel documentation system. PCR amplification products were sequenced. The resulting DNA sequences were analyzed by the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/).
Table 2

Primers used in PCR and DNA sequencing

Gene

Nucleotide sequence (5′ to 3′)

Expected size of amplicon (bp)

Reference or source

intI1/intI1

F1: GCATCCTCGGTTTTCTGG

R1: GGTGTGGCGGGCTTCGTG

457

[8]

intI2/intI2

F2: CACGGATATGCGACA AAA AGGT

R2: GTAGCA AACGAGTGACGA AATG

789

[8]

intI3/intI3

F3: ATCTGCCAA ACCTGACTG

R3: CGA ATGCCCCAACAACTC

922

[8]

hep58/hep59

F4: TCATGGCTTGTTATGACTGT

R4: GTAGGGCTTATTATGCACGC

Unknown

[9]

hep74/hep51

F5: CGGGATCCCGGACGGCATGCACGATTTGTA

R5: GATGCCATCGCAAGTACGAG

Unknown

[10]

orf513F/orf513R

F6: ATGGTTTCATGCGGGTT

R6: CTGAGGGTGTGAGCGAG

475

[11]

orf513F/sul1R

F7: ATGGTTTCATGCGGGTT

R7: TTTGAAGGTTCGACAGC

Unknown

[11]

Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST)

Bacterial genomic DNA was prepared in agarose plugs and digested with the restriction enzymes XbaI (Promega, USA). The DNA fragments were separated by use of a CHEF Mappar XA PFGE system (Bio-Rad, USA), with running time of 22 h and pulse times ranging from 5 to 40 s. The running buffer was 0.5 × Tris-boric acid-EDTA (TBE). Salmonella ser. Braenderup H9812 was used as a standard for comparison. PFGE patterns were compared visually following previously described criteria [12]. Multilocus sequence typing (MLST) was performed on representative isolates. Internal fragments of the seven housekeeping genes were amplified using the primers given at the Institute Pasteur MLST Databases web site (http://pubmlst.org/ecloacae/). The PCR products were sequenced. Sequence types (STs) were assigned using online database tools.

Conjugation experiments and Plasmid analysis

The transfer of carbapenem resistance was tested using a conjugation test, E. coli 600 (rifampicin-resistant) was used as the recipient strain, NDM-1-producing E. cloacae clinical isolates were used as the donor strains. Donor and recipient cells from M–H broth cultures were mixed in a ratio of 2:1 and transconjugant clones were screened on M–H agar plates containing rifampicin (256 mg/L) and Imipenem (1 mg/L). Conjugation events occurred at 37 °C. The presence of the bla NDM-1 gene in transconjugants was determined by PCR and sequencing. Genomic DNA was digested with S1 nuclease (Promega, USA). The linearized plasmids and partially digested genomic DNA were separated through the CHEF-Mapper XA PFGE system with a switch time from 2.16 to 63.8 s for 18 h at 6 V/cm at 14 °C. Linear plasmids generated by S1-PFGE were transferred to nvlon membrane (Millipore, USA) and hybridized with a digoxigenin-labeled probe specific to bla NMD-1. Probe labeling and signal detection were carried out with DIG high primer DNA labeling and detection starter kit according to the manufacturer’s instructions (Roche Applied Sciences, Germany).

Results

Antimicrobial susceptibility testing

The antibiotic susceptibility results showed that all the NDM-1-producing E. cloacae isolates exhibited resistance to carbapenems, cephalosporins and penicillins. Only one isolates remained susceptible to aztreonam, which was not hydrolysed by metallo-carbapenemases, thus suggesting the presence of additional β-lactamases in the remaining isolates. Ten isolates exhibited different level resistance to tetracycline, amikacin, ciprofloxacin and tigecycline, seven isolates were resistance to tetracycline, one to amikacin, nine to ciprofloxacin and one to tigecycline. These results are summarized in Table 3.
Table 3

Antimicrobial drug susceptibility profiles (MICs in mg/L) for clinical isolates and transconjugants

Isolate no.

VITEK2

E test

PIP

TCY

ATM

CAZ

CIP

AMK

MEM

IMP

ETP

TGC

MEM

IMP

ETP

T1

≥128

≥16

≥64

≥64

≥4

16

8

8

≥8

1

>32

32

>32

T2

≥128

4

≥64

≥64

≥4

≤2

≥16

≥16

≥8

1

>32

>32

>32

T3

≥128

≥16

≥64

≥64

≥4

≥64

8

≥16

≥8

≥8

>32

>32

>32

T4

≥128

8

≥64

≥64

≥4

4

≥16

≥16

≥8

1

>32

24

>32

T5

≥128

≥16

16

≥64

≥4

4

≥16

≥16

≥8

2

>32

>32

>32

T6

≥128

≥16

≥64

≥64

≥4

16

≥16

≥16

≥8

1

32

>32

>32

T7

≥128

≥16

16

≥64

≥4

16

≥16

≥16

≥8

2

>32

>32

>32

T8

≥128

≥16

≥64

≥64

≥4

16

≥16

≥16

≥8

1

>32

>32

>32

T9

≥128

≥16

≤1

≥64

0.5

≤2

≥16

≥16

≥8

1

>32

>32

>32

T10

≥128

4

≥64

≥64

≥4

≤2

4

4

≥8

2

6

8

8

T1-EC600

≥128

≤1

≤1

≥64

0.5

≤2

8

≥16

≥8

1

8

8

8

T2-EC600

≥128

≤1

32

≥64

0.5

≤2

≥16

≥16

≥8

1

8

16

>32

T3-EC600

≥128

≤1

≤1

≥64

0.5

≤2

8

≥16

≥8

2

16

16

>32

T4-EC600

≥128

≥16

32

≥64

0.5

≤2

8

≥16

≥8

1

>32

6

8

T5-EC600

≥128

≤1

≤1

≥64

0.5

≤2

8

≥16

≥8

2

>32

>32

>32

T6-EC600

≥128

≤1

≤1

≥64

0.5

≤2

≥16

≥16

≥8

1

>32

>32

>32

T7-EC600

≥128

≤1

≤1

≥64

0.5

≤2

≥16

≥16

≥8

1

24

8

8

T8-EC600

≥128

≤1

≤1

≥64

0.5

≤2

8

≥16

≥8

1

>32

>32

>32

T9-EC600

≥128

≤1

≤1

≥64

0.5

≤2

≥16

≥16

≥8

1

24

>32

24

T10-EC600

≥128

≤1

≤1

≥64

0.5

≤2

≥16

≥16

≥8

1

>32

>32

16

EC600

≤4

≤1

≤1

≤1

≤0.25

≤2

≤0.25

≤1

≤0.5

≤0.5

0.032

0.019

0.008

ATCC25922

≤4

≤1

≤1

≤1

≤0.25

≤2

≤0.25

≤1

≤0.5

≤0.5

0.032

0.019

0.008

EC600 Escherichia coli 600, T1-EC600 the transconjugants of T1 strain, PIP piperacillin, TCY tetracycline, ATM aztreonam, CAZ ceftazidime, CIP ciprofloxacin, AMK amikacin, MEM meropenem, IPM imipenem, ETP ertapenem, TGC tigecycline

Detection of integrons and ISCR1

Class 1 integrase gene was detected in 80% (8/10), while the variable region of class 1 integron was detected in 70% (7/10) NDM-1-producing E. cloacae isolates. Among them, six different gene cassette arrays were found, which included: dfrA12+aadA2, dfrA15+dfrA17, aadA2+aadA5+dfrA17, dfrA15+aadB+aadA2, dfrA15 and dfrA15+aac (6′)-Ib-cr. Those genes encoded resistance to aminoglycosides and sulfamethoxazole/trimethoprim. 10% (1/10) strains possessed class 2 integron, and the variable region of class 2 integron harbored sat2+aadA1 genes, which mediated antibiotic resistance to streptothricin and streptomycin. None of the isolates harbored class 3 integron. 50% (5/10) isolates carried ISCR1 elements. However, in the five ISCR1 positive isolates, the cassette arrays could not be detected.

PFGE and MLST typing

According to Tenover’s criteria [12], Six E. cloacae isolates, of which four obtained from transplantation center, one from general practice and one from emergency intensive care unit, belonged to ST74 and shared the same PFGE fingerprint pattern (Fig. 1), suggesting they were clonally related, the remaining strains were characterized by unique genotypes. MLST of representative isolates assigned the E. cloacae to four sequence type (ST), ST74, ST182, ST754 and ST175, respectively.
Fig. 1

Pulsed-field gel electrophoresis (PFGE) of XbaI-digested DNA of E. cloacae isolates. Lane M PFGE marker, Salmonella ser. Braenderup H9812; lanes 110 representative NDM-1-producing E. cloacae

Plasmid analysis

Conjugation experiments revealed that plasmids harboring bla NDM-1 were transformed into E. coli 600. All transconjugants conferred resistance to carbapenems, cephalosporins and penicillins while all of them remained susceptible to ciprofloxacin and amikacin (Table 1). Isolates harbored three to five plasmids according to S1-PFGE electrophoresis. Southern hybridization analysis with a bla NDM-1-specific probe revealed that bla NDM-1 was located on a ~33.3 kb plasmid in nine isolates and on a ~50 kb plasmid in one isolates (Fig. 2).
Fig. 2

Results of S1 nuclease PFGE and Southern blot hybridization. Lane M PFGE marker, Salmonella ser. Braenderup H9812; lanes 17 Strains (T1–T7) digested with S1 nuclease; lanes 814 hybridized plasmids of strains (T7–T1) with the bla NDM-1 probe; lanes 1517 strains (T8–T10) digested with S1 nuclease; lanes 18–20 hybridized plasmids of strains (T8–T10) with the bla NDM-1 probe

Discussion

The bla NDM-1 was first identified in a clinical isolate of K. pneumoniae in New Delhi, India, and suddenly got disseminated around the world. The bla NDM-1-carrying bacteria conferred resistance to all most β-lactam antibiotics. Thus, treatment of infections with NDM-producing bacteria was a major challenge, leaving few options for clinical treatment beside tigecycline or colistin. The bla NDM-1 gene have been identified in a variety of gram-negative bacilli, including Acinetobacter spp. [13], Enterobacteriaceae [14] and Pseudomonas aeruginosa [15]. Lack of uncontaminated potable water and abuse of over-the-counter antibiotic administration offered the ideal setting for the development of a latent endemic situation, and international “medical tourism” played an important role in the spread of bla NDM-1 gene [16]. Yunnan Kunming is a famous tourist city in the world, and large numbers of domestic and foreign tourists come here every year, thus “medical tourism” may play an important role in the spread of bla NDM-1 among carbapenem-resistant bacteria in this region.

In China, plasmid-carrying blaNDM-1 have been identified in Enterobacteriaceae isolates in several regions including Beijing, Shanghai, Hong Kong, Shandong Henan and Yunnan province, the size of plasmids harboring bla NDM-1 were vary from ~50 to 360 kb [17, 18]. Our research shows that bla NDM-1 gene was mainly located on a plasmid with ~33.3 kb size, were different from previously reported in China before. The bla NDM-1 gene was not detected in integrons and ISCR1 mobile elements. Integrons only carried these genes encoding resistance to aminoglycosides [aadA1, aadA2, aadA5, aadB, aac(6′)-Ib-cr], sulfamethoxazole/trimethoprim (dfrA17, dfrA12, dfrA15) and Streptozotocin (sat2). Those results suggested that plasmid was the most important mobile element that mediated the dissemination of bla NDM-1 and integrons were the basis for the formation of multiple drug-resistant bacteria in the region. In addition, it was worth noting that there had been some evidences which demonstrated that integrons and ISCR mobile elements were located on plasmids [4], thus, the resistance gene through the plasmids spreading was not a single element, but by 1 + 1 or 1 + 2 mode. This mode of dissemination should arouse high concern of the relevant departments.

Clonal spread was an important factor involved in the prevalence of NDM-1-producing Enterobacteriaceae. Outbreak of NDM-1-producing K. pneumoniae ST105 and ST147 have been reported in Yunnan [17] and Xi’an [19], and NDM-1-producing E. cloacae ST120 have been reported in Henan [18], China, respectively. Our study showed that 5 clusters for 10 strains, 1 cluster from 6 closely related isolates was found to exhibit similarities which is more than 90%. The result suggested that 6 NDM-1-producing E. cloacae isolates were clonally related. However, there was no significant epidemiological relatedness among them. Hence, we could not trace their origin. MLST analysis revealed four ST types including ST74, ST754, ST175 and ST182, among them, ST74 was the major type in NDM-1-producing E. cloacae isolates, which was different from previous types reported before such as ST66, ST78, ST108, ST114 and ST120 [18]. ST74 has been identified among non-susceptible to ertapenem of E. cloacae isolates in North-Eastern France, and was associated with OXA-48-producing E. cloacae isolates in Spain [20, 21]. The present study is the first to report on an outbreak of NDM-1-producing E. cloacae ST74.

Infection control measures were strengthened to prevent the further transmission of bla NDM-1. They included hand hygiene, contact isolation, active screening, environmental surface disinfection, standard aseptic manipulation techniques, among them, hand hygiene was the most effective and economical strategy for reducing cross infection [16].

To conclude, our study demonstrated that plasmids were the most important elements that mediate horizontal transfer of the bla NDM-1 gene. Furthermore, we identified a potential endemic clone of ST74. The emergence of NDM-1-producing E. cloacae ST74 isolates is worrying, nosocomial surveillance system should pay more attention to prevent their further spread.

Abbreviations

NDM-1: 

New Delhi metallo-beta-lactamase 1

ISCR1: 

insertion sequence common region 1

PCR: 

polymerase chain reaction

PFGE: 

pulse field gel electrophoresis

MLST: 

multilocus sequence typing

MBLs: 

metallo-β-lactamases

5CS & 3CS: 

5′ & 3′-conserved segments

CLSI: 

Clinical and Laboratory Standards Institute

M–H: 

Mueller–Hinton

MIC: 

minimum inhibitory concentration

Declarations

Authors’ contributions

YD designed the study; ND drafted the first version of this manuscript; SL and MN collected the isolates and clinical informations; ND performed the PFGE; ND and JM preformed the antimicrobial susceptibility test and conjugation experiment; RC, JY, MZ, SL, MN and ND carried out the molecular biology experiments. YD and YD participated in manuscript correction. All authors read and approved the final manuscript.

Acknowledgements

Escherchia coli 600 and Salmonella ser. Braenderup H9812 was a kind gift from Prof. Yunsong Yu, the First Affiliated Hospital of Zhejiang University. This study was supported by grants from the Health and Family Planning Commission of Yunnan Province (Grant No. 2016NS030).

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

All data and materials are available.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Clinical Laboratory, the First Affiliated Hospital of Kunming Medical University, Yunnan Institute of Laboratory Diagnosis, Yunnan Key Laboratory of Laboratory Medicine

References

  1. Miyoshi-Akiyama T, Hayakawa K, Ohmagari N, Shimojima M, Kirikae T. Multilocus sequence typing (MLST) for characterization of Enterobacter cloacae. PLoS ONE. 2013;8(6):e66358. doi:10.1371/journal.pone.0066358.View ArticlePubMedPubMed CentralGoogle Scholar
  2. Yang FC, Yan JJ, Hung KH, Wu JJ. Characterization of ertapenem-resistant Enterobacter cloacae in a Taiwanese University Hospital. J Clin Microbiol. 2012;50(2):223–6. doi:10.1128/JCM.01263-11.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, Walsh TR. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrobial Agents Chemother. 2009;53(12):5046–54.View ArticleGoogle Scholar
  4. Zhao WH, Hu ZQ. Acquired metallo-β-lactamases and their genetic association with class 1 integrons and ISCR elements in Gram-negative bacteria. Futur Microbiol. 2015;10(5):873–87. doi:10.2217/fmb.15.18.View ArticleGoogle Scholar
  5. Carattoli A. Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents Chemother. 2009;53(6):2227–38. doi:10.1128/AAC.01707-08.View ArticlePubMedPubMed CentralGoogle Scholar
  6. Lima AM, de Melo ME, Alves LC, Brayner FA, Lopes AC. Investigation of class 1 integrons in Klebsiella pneumoniae clinical and microbiota isolates belonging to different phylogenetic groups in Recife, State of Pernambuco. Rev Soc Bras Med Trop. 2014;47(2):165–9.View ArticlePubMedGoogle Scholar
  7. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: twenty-fourth informational supplement update document M100-S24. Wayne: CLSI; 2014.Google Scholar
  8. Shibata N, Doi Y, Yamane K, Yagi T, Kurokawa H, Shibayama K, Kato H, Kai K, Arakawa Y. PCR typing of genetic determinants for metallo-beta-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J Clin Microbiol. 2003;41(12):5407–13.View ArticlePubMedPubMed CentralGoogle Scholar
  9. White PA, McIver CJ, Deng Y, Rawlinson WD. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol Lett. 2000;182(2):265–9.View ArticlePubMedGoogle Scholar
  10. White PA, McIver CJ, Rawlinson WD. Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother. 2001;45(9):2658–61.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Quiroga MP, Andres P, Petroni A, Soler Bistué AJ, Guerriero L, Vargas LJ, Zorreguieta A, Tokumoto M, Quiroga C, Tolmasky ME, Galas M, Centrón D. Complex class 1 integrons with diverse variable regions, including aac(6′)-Ib-cr, and a novel allele, qnrB10, associated with ISCR1 in clinical enterobacterial isolates from Argentina. Antimicrob Agents Chemother. 2007;51(12):4466–70.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33(9):2233–9.PubMedPubMed CentralGoogle Scholar
  13. Huang TW, Lauderdale TL, Liao TL, Hsu MC, Chang FY, Chang SC, Khong WX, Ng OT, Chen YT, Kuo SC, Chen TL, Mu JJ, Tsai SF. Effective transfer of a 47 kb NDM-1-positive plasmid among Acinetobacter species. J Antimicrob Chemother. 2015;70(10):2734–8. doi:10.1093/jac/dkv191.View ArticlePubMedGoogle Scholar
  14. Qu H, Wang X, Ni Y, Liu J, Tan R, Huang J, Li L, Sun J. NDM-1-producing Enterobacteriaceae in a teaching hospital in Shanghai, China: IncX3-type plasmids may contribute to the dissemination of blaNDM-1. Int J Infect Dis. 2015;34:8–13. doi:10.1016/j.ijid.2015.02.020.View ArticlePubMedGoogle Scholar
  15. Zafer MM, Amin M, El Mahallawy H, Ashour MS, Al Agamy M. First report of NDM-1-producing Pseudomonas aeruginosa in Egypt. Int J Infect Dis. 2014;29:80–1. doi:10.1016/j.ijid.2014.07.008.View ArticlePubMedGoogle Scholar
  16. Voulgari E, Gartzonika C, Vrioni G, Politi L, Priavali E, Levidiotou-Stefanou S, Tsakris A. The Balkan region: NDM-1-producing Klebsiella pneumoniae ST11 clonal strain causing outbreaks in Greece. J Antimicrob Chemother. 2014;69(8):2091–7. doi:10.1093/jac/dku105.View ArticlePubMedGoogle Scholar
  17. Zheng R, Zhang Q, Guo Y, Feng Y, Liu L, Zhang A, Zhao Y, Yang X, Xia X. Outbreak of plasmid-mediated NDM-1-producing Klebsiella pneumoniae ST105 among neonatal patients in Yunnan. China. Ann Clin Microbiol Antimicrob. 2016;15:10. doi:10.1186/s12941-016-0124-6.View ArticlePubMedGoogle Scholar
  18. Liu C, Qin S, Xu H, Xu L, Zhao D, Liu X, Lang S, Feng X, Liu HM. New Delhi metallo-β-lactamase 1(NDM-1), the dominant carbapenemase detected in carbapenem-resistant Enterobacter cloacae from Henan province, China. PLoS ONE. 2015;10(8):e0135044. doi:10.1371/journal.Pone.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Wang X, Xu X, Li Z, Chen H, Wang Q, Yang P, Zhao C, Ni M, Wang H. An outbreak of a nosocomial NDM-1-producing Klebsiella pneumoniae ST147 at a teaching hospital in mainland China. Microb Drug Resist. 2014;20(2):144–9. doi:10.1089/mdr.2013.0100.View ArticlePubMedGoogle Scholar
  20. Fernández J, Montero I, Martínez Ó, Fleites A, Poirel L, Nordmann P, Rodicio MR. Dissemination of multiresistant Enterobacter cloacae isolates producing OXA-48 and CTX-M-15 in a Spanish hospital. Int J Antimicrob Agents. 2015;46(4):469–74. doi:10.1016/j.ijantimicag.2015.07.003.View ArticlePubMedGoogle Scholar
  21. Guillard T, Cholley P, Limelette A, Hocquet D, Matton L, Guyeux C, Lebreil AL, Bajolet O, Brasme L, Madoux J, Vernet-Garnier V, Barbe C, Bertrand X, de Champs On Behalf of CarbaFrEst Group C. Fluoroquinolone Resistance Mechanisms and population structure of Enterobacter cloacae non-susceptible to Ertapenem in North-Eastern France. Front Microbiol. 2015; 6:1186. doi:10.3389/fmicb.2015.01186.

Copyright

© The Author(s) 2017

Advertisement