Skip to main content

Table 2 Primers used in the amplification of selected carbapenemase genes

From: Characteristics of multidrug-resistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection

Name Nucleotide sequence (5′ → 3′) Product size (bp) Location References
OXA-23-like F- GATCGGATTGGAGAACCAGA 501 blaOXA-23 [31]
R- ATTTCTGACCGCATTTCCAT
OXA-24-like F- GGTTAGTTGGCCCCCTTAAA 246 blaOXA-24 [31]
R- AGTTGAGCGAAAAGGGGATT
OXA-51-like F- TAATGCTTTGATCGGCCTTG 353 blaOXA-51 [31]
R- TGGATTGCACTTCATCTTGG
OXA-58-like F- AAGTATTGGGGCTTGTGCTG 599 blaOXA-58 [31]
R- CCCCTCTGCGCTCTACATAC
IMPa F- GGAATAGAGTGGCTTAAYTCTC 232 blaIMP [32]
R- GGTTTAAYAAAACAACCACC
VIM F- GATGGTGTTTGGTCGCATA 390 blaVIM [32]
R- CGAATGCGCAGCACCAG
SPM F- AAAATCTGGGTACGCAAACG 271 blaSPM [32]
R- ACATTATCCGCTGGAACAGG
NDM F- GGTTTGGCGATCTGGTTTTC 621 blaNDM [32]
R- CGGAATGGCTCATCACGATC
GES F-ATGCGCTTCATTCACGCAC 863 blaGES [33]
R-CTATTTGTCCGTGCTCAGGA
GES F- CGGTTTCTAGCATCGGGACACAT 263 blaGES [34]
R- CCGCCATAGAGGACTTTAGCMACAG
Probe: Quasar 705-CGACCTCAGAGATACAACTACGCCTATTGC-BHQ2
NDM-1 F- ATTAGCCGCTGCATTGAT 154 blaNDM [35]
R- CATGTCGAGATAGGAAGTG
Probe: FAM-CTG[+ C]CA [+ G]AC [+ A]TT [+ C]GG TGC-TAMRA
KPC F- GATACCACGTTCCGTCTGG 246 blaKPC [36]
R- GCAGGTTCCGGTTTTGTCTC
Probe: FAM-AGCGGCAGCAGTTTGTTGATTG-3′–BHQ1
  1. aY = C or T