Skip to main content
Download PDF

Distribution of bla OXA-23, IS Aba , Aminoglycosides resistant genes among burned & ICU patients in Tehran and Sari, Iran

Annals of Clinical Microbiology and Antimicrobials volume 13, Article number: 38 (2014) Cite this article

Abstract

Background

Multidrug resistant strains of Acinetobacter baumannii (MDR-AB) have emerged as alarming nosocomial pathogens among patients admitted to Intensive Care Unit and burned patients. The aim of this study was to determine the susceptibility of A. baumannii isolates, the carbapenems resistance patterns bla OXA-23 and also IS Aba elements of A. baumannii isolates among burned and ICU patients in Tehran and Sari, Iran.

Methods

In this study, 100 A. baumannii isolates from burned and ICU patients in Tehran and Sari (Iran) during 2013 were tested for determination of antimicrobials susceptibility by the disc-diffusion method on Mueller Hinton agar recommended by the guidelines of Clinical and Laboratory Standards Institute (CLSI), and frequency blaOXA-23 carbapenemase genes, and insertion elements IS Aba genes were studied by PCR method.

Results

The highest rates of susceptibility were observed with Colistin (88.7%), Tigecycline (82.2%), Imipenem (67%) and ISAba (32.2%). The extensively drug-resistance and pan drug-resistance were observed in 37.1% and 8.1% isolates, respectively.

Results indicated among isolates resistant to Aminoglycoside and Carbapenem, the highest resistance was observed to Streptomycin (90%) and the most sensitivity was to Imipenem (67%)

Conclusions

This is the most study that attempted to detect Acinetobacter baumanii the insertion elements IS Aba , bla OXA-23 and aminoglycosides resistance in MDR-AB isolates from burned and ICU patients in Iran. In a timely manner, antimicrobial resistance surveillance and strict infection control strategies are still lacking in burn ward and ICU in Iran, despite the alarming emergence of MDR-AB strains, particularly among those isolates that are not susceptible to Colistin. The results of this study are consistent with a recent report in which a number of combinations exhibited potent activity against Multidrug resistant strains of A. baumannii (MDR-AB).

Background

Multidrug drug-resistant (MDR) and extensively drug-resistance (XDR) strains of Acinetobacter baumannii have emerged as formidable nosocomial pathogens among burned patient [1],[2].

In developing countries, such as Iran, clinicians face serious challenges in management of burned patients with MDR- A. baumannii (MDR-AB) infections, which present significant health care challenges by prolonging hospitalization, treatment failures, and increased mortality [3].

Members of the genus Acinetobacter have been implicated in a wide spectrum of infectious diseases such as Respiratory Infection, Bacteremia, Meningitis and Urinary Tract Infection [4]. Acinetobacter spp infections in admitted intensive care unit (ICU) patients hospitals very dangerous and acquired resistance of A. baumannii to carbapenems has increasingly been reported all over the world during the last decade [5].

The clinical strains of A. baumannii are usually multidrug resistant to aminoglycosides, fluoroquinolones, ureidopenicillins and third generation cephalosporins. Carbapenems were considered to be the mostactive antimicrobials against A. baumannii. However, Carbapenem resistance is rising and is often associated with a multidrug resistance phenotype [6],[7].

Carbapenems are currently the drug of choice; however, clonal outbreaks of carbapenems resistant A. baumannii (CR-AB) have led to an inadequacy of therapeutic choices in treating MDR-AB infections among patients in developing countries [8]. While expression of blaOXA genes play a major role in carbapenem resistance among CR-AB [9]), blaOXA mediated carbapenem resistance requires enhancement of gene expression either by insertion element IS Aba [10]-[12].

Despite a few reports on the distribution and/or frequency of resistance genes among CR-AB isolate from burned patients in Iran [13],[14], the scarcity of molecular epidemiologic data has rendered national efforts to control the spread of CR-AB infections unsuccessful. To date, no extensive studies have addressed the distribution of bla oxa-23, IS Aba and distribution in MDR-AB strains that cause infection in burned and ICU patients in Iran.

We in this research surveyed susceptibility of A. baumannii isolates, the carbapenems and Aminoglycosides resistance patterns, and its association with IS Aba elements of A. baumannii isolates among burned and ICU patients in Tehran and Sari, Iran. We obtain consent from the patient for the publication of this report.

Methods

Bacterial isolates

During 2013, a total of 100 non-repetitive clinical isolates of A. baumannii were collected from the burned patients of a tertiary burn and ICU center in Tehran and Sari, Iran as described previously [1]. All of the patients have given his/her consent for the report to be published. All study-related materials before and during the trial were operated in accordance with national and/or local regulations, as well as with ICH good clinical practices (GCPs) guidelines.

Identification of Acinetobacter species

Initially, isolates were identified as A. baumannii using API-20NE system [15],[16]. All the clinical Isolates were kept at -20°C in CRYOBANK (Copan Diagnostics Inc., Canada) until further testing.

Bacterial identification

During a One year period, 100 specimens A. baumannii (MDR) were isolated from patients that were admitted to Intensive Care Unit and burned patients with proved nosocomial infections in Tehran and Sari(Iran). The strains were isolated from the trachea and burned skin. We considered a strain as MDR if it was resistant to two or more antibiotic classes. Patients had no bacterial infections at the time of admitted to hospital. All the samples were confirmed as A. baumanni by biochemical Tests.

Antimicrobial susceptibility tests

Susceptibility to various antimicrobial agents was determined by the disc-diffusion method on Mueller Hinton agar recommended by the guidelines of Clinical and Laboratory Standards Institute (CLSI). Briefly, 0.1ml of a suspension of the test microorganism (1.5*10 8cfu /ml) was spread on Mueller-Hinton Agar (diameter, 90mm) (Merck), by the disc diffusion method for the following antimicrobial agents (Mast/Rosco) with concentrations: Streptomycin (10µg), Tobramycin (10µg), Gentamicin (10µg) Kanamycin (10µg), Imipenem (10µg) and Meropenem (10µg) were then placed on the agar plate and incubated at 37°C for 24h. The diameters of the zones of inhibition were measured and reported in mm.

Isolates of A. baumannii were defined as multidrug-resistant (MDR) when the organism was resistant to at least one agent in three or more antimicrobial categories that would otherwise serve as treatments for Acinetobacter infection.

An isolate was considered extensively drug-resistance (XDR) when it was non-susceptible to one or more of agent in all but 2 or less the categories. Pan drug resistant (PDR) was defined as non-susceptibility to all antimicrobial agents [17].

DNA extraction, synthetic primers and PCR Assay

DNA extraction was carried out by commercial DNA extraction kit (CinnaGen, Iran).The presence of bla OXA-23Carbapenemases gene was detected by PCR. PCR was performed in a standard enzyme Taq DNA polymerase. Single primer pair was used to amplify blaOXA-23 gene target fragment based on GenBank. The primers sequences as follows: Primer F: CCGTCGTTTACGACATTCA and blaOXA-23 R: AAAGAGCGCATTGCTTTGAT. For PCR reaction we used CinnaGen Master Mix and reactions were performed in a final volume of 25 ?According to Primer (10µmol, DNA template (50ng). PCR was performed in a standard enzyme PCR system (Cinnagen) concentration reaction, Master Mix (1x) each, primer, template DNA 50ng. The mixtures were incubated for 4min at 94oc for primary denaturation, 60sec at 94oc for secondary denaturation of the target DNA and then, annealing at 50oc for 1min, and extension at 72oc for 1min that 35cycle was performed. The amplified products were analyzed by electrophoresis on 1% agarose gel (cinnagen) containing 0.1g of ethidium bromide per ml in TAE buffer. The PCR product was visualized under UV light and photographed.

To determine the frequency of IS Aba elements sets of primers (IS Aba 1F/OXA-23R and ISAba 4F/OXA-23R) was used, respectively. PCR primers were designed using Primer 3 plus software (version 4.0; http://primer3.wi.mit.edu/; accessed 05.06.11) with sequences IS Aba 1F: TGAGATGTGTCATAGTATTC, IS Aba /OXA23 R: AGAGCATTACCATATAGATT. PCR assays were performed under standard conditions.

Results

In total, 100 Acinetobacter baumannii isolates were isolated from patients that were admitted to Intensive Care Unit and burned patients in Tehran and Sari (Iran). During 2013, we observed that, 62% isolates showed resistance to aminoglycosides and carbapenems. Based on the susceptibility of the isolated Acinetobacter baumannii to number of antibiotics, was observed minimum resistance against Imipenem (67%) and Meropenem (74%) and maximum resistance against Streptomycin (90%), Gentamicin (83%), Tobramycin (83%) and kanamycin (80%).The results of PCR screening from 61 Acinetobacter baumannii resistant to aminoglycosides and carbapenems, 41(67%) isolates have bla OXA-23 carbapenemase gene and IS Aba (32.2%).

Discussion

Nosocomial infections caused by multidrug resistant strains of Acinetobacter baumannii (MDR-AB) are currently among the most difficult to treat, and they continue to present serious challenges to clinicians empirical and therapeutic decisions in burned patient [1]. Outbreaks of extensively, and pan drug-resistant A. baumannii (XDR, and PDR, respectively) currently has been reported from worldwide. In this study, the high prevalence of XDR and PDR A. baumannii isolates (37.1% and 8.1%, respectively) from burned patient is consistent with previous reports.

The present study revealed that 17.8% vs 41.8% and 11.3% vs 0%of A. baumannii isolates from burned patients are resistant to Tigecycline and Colistin, respectively, by comparison with the other studies in Iran [1],[18].

Acinetobacter baumannii is one of the most important nosocomial pathogens, able to cause severe infections, occurring principally in immunosuppressed patients, in patients with serious underlying diseases, or subjected to invasive procedures and treatment with broad-spectrum antibiotics. A. baumannii isolates resistant to various classes of antibiotics are emerging worldwide, and the recent resistance or reduced susceptibility to carbapenems, is considered aserious clinical problem due to the role of first choice therapy that these drugs have had until now [19]. A. baumannii isolates resistant to various classes of antibiotics are emerging worldwide, and the recent resistance or reduced susceptibility to carbapenems, is considered as serious clinical problem due to the role of first choice therapy that these drugs have had until now.Demonstrated that A. baumannii was the third pathogen for severity in high-risk wards, frequently derived from nosocomial pneumonia or bacteremia [10].

In a timely manner, antimicrobial resistance surveillance and strict infection control strategies are still lacking in burn ward in Iran, despite the alarming emergence of MDR-AB strains, particularly among those isolates that are not susceptible to Colistin. The emergence of Colistin-resistant A. baumannii in this study might be due to differences in A. baumannii strains available for study or increasing empirical use of Colistin. However, it is still unknown whether this obvious resistance to Colistin in A. baumannii isolates from burned patients in Iran was due to increase of A. baumannii virulence or other intervening factor. Interestingly, all Colistin resistant isolates were susceptible to Tigecycline and/or Tobramycin. This is very important for treating serious infections caused by Colistin resistance isolates. However, this combination still needs to be validated in animal model and clinical trials. The results of this study are consistent with a recent report in which a number of combinations exhibited potent activity against multidrug resistant strains of A. baumannii (MDR-AB) [20].

Although the presence of IS Aba to play a substantial role in antimicrobial resistance in MDR-AB isolates, according to the best of our knowledge there is no data on the presence of IS Aba in MDR-AB strains isolated from burn patients in Iran. However, further investigation is required to recover various IS Aba in MDR-AB strains isolated from Iran.

This research showed that, it was notified that, the Acinetobacter baumannii resistant to aminoglycoside and Carbapenem in Tehran and Sari are rising dangerously. We have documented those almost more than half strains are resistant to carbapenems and aminoglycosides. Also we observed that resistance to aminoglycosides was higher than carbapenems.Carbapenem-resistance in these strains is due to the presence of bla OXA-23 gene and we show that this gene, carried in 67%.

In conclusion, our data support that Tigecycline alone or plus Tobramycin exhibited a potent activity against Colistin-resistant A. baumannii isolates from burned patients. Acinetobacter baumannii strains isolated from Iranian burned patients are so heterogeneous and this is the first report of spreading of IS Aba in the upstream of blaOXA genes in MDR-AB isolates among burned patients in Iran. We also show that MDR-AB integrons were present among burned patients in Iran at almost the same time as they were described worldwide.

Acinetobacter baumannii strains isolated from Iranian burned patients are so heterogeneous and this is the first report of spreading of IS Aba in the upstream of blaOXA genes in MDR-AB isolates belonging to burned patients in Iran. Antimicrobial resistance surveillance and strict infection control strategies are still lacking in burn ward and ICU in Iran, despite the alarming emergence of MDR-AB strains, particularly among those isolates that are not susceptible to Colistin. The results of this study are consistent with a recent report in which a number of combinations exhibited potent activity against multidrug resistant strains of A. baumannii (MDR-AB).

Authors contributions

This work was carried out in collaboration between all authors. DE designed the Performed studies and wrote the first draft of the manuscript. AB managed and assisted in the data analyses. Other author s designed, advised, evaluated the data, and finalized the manuscript for publication. All authors read and approved the final manuscript.

References

  1. Yali G, Jing C, Chunjiang L, Cheng Z, Xiaoqiang L, Yizhi P: Comparison of pathogens and antibiotic resistance of burn patients in the burn ICU or in the common burn ward. Burns 2013.

  2. Rezaei E, Safari H, Naderinasab M, Aliakbarian H: Common pathogens in burn wound and changes in their drug sensitivity. Burns 2011, 37: 805-807. 10.1016/j.burns.2011.01.019

    Article  PubMed  Google Scholar 

  3. Higgins PG, Dammhayn C, Hackel M, Seifert H: Global spread of carbapenem-resistant Acinetobacter baumannii . J Antimicrob Chemother 2010, 65: 233-238. 10.1093/jac/dkp428

    Article  PubMed  CAS  Google Scholar 

  4. Chul Hee Choi1, Jun Sik Lee1, Yoo Chul L, in Park T, Je Chul L: Acinetobacter baumannii invades epithelial cells and outermembrane protein A mediates interactions with epithelial cells. BMC Microbiol 2008, 8: 216. 10.1186/1471-2180-8-216

    Article  Google Scholar 

  5. Joly-Guillou M-L: Clinical impact and pathogenicity of Acinetobacter. Clin Microbial Infect 2005, 11: 868-873. 10.1111/j.1469-0691.2005.01227.x

    Article  Google Scholar 

  6. Maragakis LL, Perl TM: Acinetobacter baumannii: epidemiology, antimicrobial resistance, and treatment options. Clin Infect Dis 2007, 46: 1254-1263. 10.1086/529198

    Article  Google Scholar 

  7. Barbara Z, Ilaria V: Inhibitors of multidrug resistant efflux systems in bacteria. Bentham Science Publishers Ltd; 2009.

    Google Scholar 

  8. Snchez A, Gattarello S, Rello J: New treatment options for infections caused by multiresistant strains of Pseudomonas aeruginosa and other non fermenting gram-negative bacilli. Semin Respir Crit Care Med 2011, 32: 151-158. 10.1055/s-0031-1275527

    Article  Google Scholar 

  9. Ruiz M, Marti S, Fernandez?Cuenca F, Pascual A, Vila J: High prevalence of carbapenem?hydrolysing oxacillinases in epidemiologically related and unrelated Acinetobacter baumannii clinical isolates in Spain. Clin Microbiol Infect 2007, 13: 1192-1198. 10.1111/j.1469-0691.2007.01825.x

    Article  PubMed  CAS  Google Scholar 

  10. Bogaerts P, Cuzon G, Naas T, Bauraing C, Deplano A, Lissoir B, Nordmann P, Glupczynski Y: Carbapenem-resistant Acinetobacter baumannii isolates expressing the blaOXA-23 gene associated with IS Aba4 in Belgium. Antimicrob Agents Chemother 2008, 52: 4205-4206. 10.1128/AAC.01121-08

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  11. Lee H-Y, Chang R-C, Su L-H, Liu S-Y, Wu S-R, Chuang C-H, Chen CL, Chiu CH: Wide spread of Tn2006 in an AbaR4-type resistance island among carbapenem-resistant Acinetobacter baumannii clinical isolates in Taiwan. Int J Antimicrob Agents 2012, 40: 163-167. 10.1016/j.ijantimicag.2012.04.018

    Article  PubMed  CAS  Google Scholar 

  12. Turton JF, Ward ME, Woodford N, Kaufmann ME, Pike R, Livermore DM, Pitt TL: The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii . FEMS Microbiol Lett 2006, 258: 72-77. 10.1111/j.1574-6968.2006.00195.x

    Article  PubMed  CAS  Google Scholar 

  13. Pajand O, Rezaee MA, Nahaei MR, Mahdian R, Aghazadeh M, Soroush MH: Study of the carbapenem resistance mechanisms in clinical isolates of Acinetobacter baumannii : Comparison of burn and non-burn strains. Burns 2013, 39: 1414-1419. 10.1016/j.burns.2013.03.024

    Article  PubMed  Google Scholar 

  14. Asadollahi P, Akbari M, Soroush S, Taherikalani M, Asadollahi K, Sayehmiri K: Antimicrobial resistance patterns and their encoding genes among Acinetobacter baumannii strains isolated from burned patients. Burns 2012, 38: 1198-1203. 10.1016/j.burns.2012.04.008

    Article  PubMed  Google Scholar 

  15. Higgins PG, Lehmann M, Wisplinghoff H, Seifert H: gyrB multiplex PCR to differentiate between Acinetobacter calcoaceticus and Acinetobacter genomic species 3. J Clin Microbiol 2010, 48: 4592-4594. 10.1128/JCM.01765-10

    Article  PubMed  CAS  PubMed Central  Google Scholar 

  16. Wang X, Chen T, Yu R, L X, Zong Z: Acinetobacter pittii and Acinetobacter nosocomialis among clinical isolates of the Acinetobacter calcoaceticus-baumannii complex in Sichuan, China. Diagn Microbiol Infect Dis 2013, 76: 392-395. 10.1016/j.diagmicrobio.2013.03.020

    Article  PubMed  Google Scholar 

  17. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A: Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infec 2012, 18: 268-281. 10.1111/j.1469-0691.2011.03570.x

    Article  CAS  Google Scholar 

  18. Feizabadi MM, Fathollahzadeh B, Taherikalani M, Rasoolinejad M, Sadeghifard N, Aligholi M: Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn J Infect Dis 2008, 61: 274-278.

    PubMed  CAS  Google Scholar 

  19. Joel F, Peleg AY: Treatment of Acinetobacter infections. Clin Infect Dis 2010,51(1):79-84. 10.1086/653120

    Article  Google Scholar 

  20. Moffatt JH, Harper M, Harrison P, Hale JD, Vinogradov E, Seemann T, Henry R, Crane B, St Michael F, Cox AD, Adler B, Nation RL, Li J, Boyce JD: Colistin resistance in Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide production. Antimicrob Agents Chemother 2010, 54: 4971-4977. 10.1128/AAC.00834-10

    Article  PubMed  CAS  PubMed Central  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. Department of Microbiology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran

    Mohtaram Nasrolahei, Bahador Zahedi & Soudeh Kholdi

  2. Departments of Microbiology, Faculty of Medicine, Tehran University of Medical Sciences, Tehran, Iran

    Abbas Bahador

  3. Applied Microbiology Research center and Microbiology Department, Baqiyatallah University Medical of Sciences, Tehran, Iran

    Hossein Saghi & Davoud Esmaeili

  4. Department of Genetic Science and Research Branch, Islamic Azad University, Tabriz, East Azerbaijan, Iran

    Neda Jalalvand

Authors
  1. Mohtaram Nasrolahei
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Bahador Zahedi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Abbas Bahador
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Hossein Saghi
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Soudeh Kholdi
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Neda Jalalvand
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Davoud Esmaeili
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Davoud Esmaeili.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2

Rights and permissions

Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( https://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Nasrolahei, M., Zahedi, B., Bahador, A. et al. Distribution of bla OXA-23, IS Aba , Aminoglycosides resistant genes among burned & ICU patients in Tehran and Sari, Iran. Ann Clin Microbiol Antimicrob 13, 38 (2014). https://doi.org/10.1186/s12941-014-0038-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12941-014-0038-0

Keywords

Annals of Clinical Microbiology and Antimicrobials

ISSN: 1476-0711

Contact us