Skip to main content
Fig. 5 | Annals of Clinical Microbiology and Antimicrobials

Fig. 5

From: Application of next-generation sequencing on diagnosis of bloodstream infection caused by Mycoplasma hominis in a patient with ANCA-associated vasculitis

Fig. 5

qPCR analysis of the Mycoplasma hominiss. We have detected blood of the patient by quantitative polymerase chain reaction with specific primers (Forward primer: CCGTTCAAGCTACCCGAACA, reverse primer: AATGCAAGCCCTCAAGGAAA) for Mycoplasma hominis we designed, which indicated infection of Mycoplasma hominis. (The yellow and red line represented two replicate for blood of the patient. The green lines represented two replicate for negative template control.)

Back to article page

Annals of Clinical Microbiology and Antimicrobials

ISSN: 1476-0711

Contact us