Skip to main content

Table 1 List of primers used for PCR amplification

From: Correlation between antimicrobial resistance and biofilm formation capability among Klebsiella pneumoniae strains isolated from hospitalized patients in Iran

Target gene Primer sequences (5′ → 3′) Product size (bp)
rpoB 5ʹ- CAACGGTGTGGTTACTGACG-3ʹ
5ʹ- TCTACGAAGTGGCCGTTTTC-3ʹ
108
blaIMP 5ʹ- TGAGCAAGTTATCTGTATTC -3ʹ
5ʹ- TTAGTTGCTTGGTTTTGATG -3ʹ
740
blaVIM 5ʹ- GATGGTGTTTGGTCGCATA-3ʹ
5ʹ- CGAATGCGCAGCACCAG-3ʹ
390
blaNDM 5ʹ- GGTTTGGCGATCTGGTTTTC-3ʹ
5ʹ- CGGAATGGCTCATCACGATC-3ʹ
621
blaOXA-48 5ʹ- TTGGTGGCATCGATTATCGG-3ʹ
5ʹ- GAGCACTTCTTTTGTGATGGC-3ʹ
428
treC 5ʹ- CCGACAGCGGGCAGTATT -3ʹ
5ʹ- CGCCGGATTCTCCCAGTT-3ʹ
71
wza 5ʹ- CGACAGTGAATGCGTCATT-3ʹ
5ʹ- TGACTGGCTTCCTGATGC-3ʹ
309
luxS 5′- GCCGTTGTTAGATAGTTTCACAG -3'
5′- CAGTTCGTCGTTGCTGTTGATG -3'
447
\