Skip to main content

Table 4 Frequency of prominent repetitive DNA sequences in DuyDNT genome

From: Whole-genome sequencing and characterization of an antibiotic resistant Neisseria meningitidis B isolate from a military unit in Vietnam

Motifs Repetitive sequences N. meningitidis DuyDNT N. meningitidis MC58 N. lactamica Y92–1009 N. gonorrhoeae NCCP11945
DUS GCCGTCTGAA 1864 1935 2247 445
AT-DUS (eDUS) ATGCCGTCTGAA 1449 1477 1718 1520
vDUS GTCGTCTGAA 173 165 90 120
AG-DUS AGGCCGTCTGAA 181 214 262 192
AG-mucDUS AGGTCGTCTGAA 102 88 45 83
veDUS ATGTCGTCTGAA 20 19 8 9
DSR3 ATTCCCNNNNNNNNGGGAAT 828 1378 454 430
Correia ATAG[CT]GGATTAACAAAAATCAGGAC 166 181 50 78
TATAG[CT]GGATTAAATTTAAACCGGTAC 1 0 1 23
TATAG[CT]GGATTAACAAAAACCGGTAC 5 8 17 40
TATAG[CT]GGATTAAATTTAAATCAGGAC 26 24 17 21
Totala 151 209 152 131
  1. aPerformed by tandem repeat finders [29]