Skip to main content

Table 1 Oligonucleotides used to detect TEM mRNA and Enterobacteriaceae (as a positive hybridization control)

From: Rapid screening for antibiotic resistance elements on the RNA transcript, protein and enzymatic activity level

Probe name Sequence (5′→3′) Target Detection purpose
Enterobac-Alexa488 TCGTGTTTGCACAGTGCTGTGTTT 23S rRNA Enterobacteriaceae (adapted with minor modifications from Bohnert et al. [23])
Enterobac-Komp TCGTGTTTGCAGAGTGCTGTGTTT 23S rRNA Competitor for Enterobacteriaceae detection (adapted with minor modifications from Bohnert et al. [23])
Bla-TEM-CalFluor610 GGAAATGTTGAATACTCAT
AAAAGGGAATAAGGGCGAC
CAGGAAGGCAAAATGCCGC
GCGTTTCTGGGTGAGCAAA
CAGCATCTTTTACTTTCAC
CTCGTGCACCCAACTGATC
GATCCAGTTCGATGTAACC
CAAGGATCTTACCGCTGTT
GTTCTTCGGGGCGAAAACT
AAGTGCTCATCATTGGAAA
CGCCACATAGCAGAACTTT
CGTCAACACGGGATAATAC
GACCGAGTTGCTCTTGCCC
TCTGAGAATAGTGTATGCG
GTGAGTACTCAACCAAGTC
TAAGATGCTTTTCTGTGAC
CTCTTACTGTCATGCCATC
TTATGGCAGCACTGCATAA
CCGCAGTGTTATCACTCAT
TCGTTGTCAGAAGTAAGTT
TTAGCTCCTTCGGTCCTCC
CCATGTTGTGCAAAAAAGC
CAAGGCGAGTTACATGATC
TCAGCTCCGGTTCCCAACG
CGTCGTTTGGTATGGCTTC
CAGGCATCGTGGTGTCACG
GCAACGTTGTTGCCATTGC
GTTCGCCAGTTAATAGTTT
GCCGGGAAGCTAGAGTAAG
CCATCCAGTCTATTAATTG
GTCCTGCAACTTTATCCGC
GAAGGGCCGAGCGCAGAAG
CAGCAATAAACCAGCCAGC
GCTCACCGGCTCCAGATTT
CAATGATACCGCGAGACCC
TACCATCTGGCCCCAGTGC
TAACTACGATACGGGAGGG
CCTGACTCCCCGTCGTGTA
TATTTCGTTCATCCATAGT
CACCTATCTCAGCGATCTG
ACCAATGCTTAATCAGTGA
mRNA TEM β-lactamase mRNA