Skip to main content

Table 1 Reference strains, target genes, primer sequences and conditions used for the detection of bacteria with PCR

From: Culture- and PCR-based detection of BV associated microbiological profile of the removed IUDs and correlation with the time period of IUD in place and the presence of the symptoms of genital tract infection

Species Target gene Forward primer (5′–3′) Amplicon size (bp) Cycling conditions References
Reverse primer (5′–3′)
N. gonorrhoeae ATCC 49981 por A pseudogene CGGTTTCCGTGCGTTACGA 131 95 °C 10 s, 55 °C 10 s, 72 °C 20 s, 55× [12]
C. trachomatis ATCC VR-902B MOMP GGGAAGGTTTCGGTGGAGAT 270 95 °C 40 s, 60 °C 40 s, 72 °C 40 s, 35× [13]
U. urealyticum ATCC 27618 MB antigen GTATTTGCAATCTTTATATGTTTTCGC 403/448 95 °C 15 s, 60 °C 60 s, 35× [14]
G. vaginalis ATCC A2508 16S rRNS GGGCGGGCTAGAGTGCA 207 95 °C 30 s, 62 °C 30 s, 72 °C 30 s, 40× [15]
A. vaginae ATCC BAA-55 ATOVAGRT3Fw GGTGAAGCAGTGGAAACACT 276 95 °C 15 s, 62 °C 20 s, 72 °C 40 s, 40× [11]
Mobiluncus spp. ATCC 35241 16S rRNS CGCAGAAACACAGGATTGCA 450 94 °C 30 s, 60 °C 30 s, 72 °C 45 s, 40× [16]