Culture- and PCR-based detection of BV associated microbiological profile of the removed IUDs and correlation with the time period of IUD in place and the presence of the symptoms of genital tract infection

Table 1 Reference strains, target genes, primer sequences and conditions used for the detection of bacteria with PCR

Species	Target gene	Forward primer (5′–3′)	Amplicon size (bp)	Cycling conditions	References
Species	Target gene	Reverse primer (5′–3′)	Amplicon size (bp)	Cycling conditions	References
N. gonorrhoeae ATCC 49981	por A pseudogene	CGGTTTCCGTGCGTTACGA	131	95 °C 10 s, 55 °C 10 s, 72 °C 20 s, 55×	[12]
N. gonorrhoeae ATCC 49981	por A pseudogene	CTGGTTTCATCTGATTACTTTCCA	131	95 °C 10 s, 55 °C 10 s, 72 °C 20 s, 55×	[12]
C. trachomatis ATCC VR-902B	MOMP	GGGAAGGTTTCGGTGGAGAT	270	95 °C 40 s, 60 °C 40 s, 72 °C 40 s, 35×	[13]
		AATTACGGTACATTCGTCGCAA
		CCGTTGAGGGGTTTTCCATTTTTGC
U. urealyticum ATCC 27618	MB antigen	GTATTTGCAATCTTTATATGTTTTCGC	403/448	95 °C 15 s, 60 °C 60 s, 35×	[14]
U. urealyticum ATCC 27618	MB antigen	CAGCTGATGTAAGTGCAGCATTAAATTC	403/448	95 °C 15 s, 60 °C 60 s, 35×	[14]
G. vaginalis ATCC A2508	16S rRNS	GGGCGGGCTAGAGTGCA	207	95 °C 30 s, 62 °C 30 s, 72 °C 30 s, 40×	[15]
G. vaginalis ATCC A2508	16S rRNS	GAACCCGTGGAATGGGCC	207	95 °C 30 s, 62 °C 30 s, 72 °C 30 s, 40×	[15]
A. vaginae ATCC BAA-55	ATOVAGRT3Fw	GGTGAAGCAGTGGAAACACT	276	95 °C 15 s, 62 °C 20 s, 72 °C 40 s, 40×	[11]
A. vaginae ATCC BAA-55	ATOVAGRT3Fw	ATTCGCTTCTGCTCGCGCA	276	95 °C 15 s, 62 °C 20 s, 72 °C 40 s, 40×	[11]
Mobiluncus spp. ATCC 35241	16S rRNS	CGCAGAAACACAGGATTGCA	450	94 °C 30 s, 60 °C 30 s, 72 °C 45 s, 40×	[16]
Mobiluncus spp. ATCC 35241	16S rRNS	GTGAACTCCTTTTTCTCGTGAA	450	94 °C 30 s, 60 °C 30 s, 72 °C 45 s, 40×	[16]

ISSN: 1476-0711