Skip to main content

Table 1 Oligonucleotides used in this study

From: An evaluation of multidrug-resistant Escherichia coli isolates in urinary tract infections from Aguascalientes, Mexico: cross-sectional study

Oligonucleotide name Target gene Oligonucleotide 5′ ➔ 3′ Amplification product (bp) References
E. coli marker
 uidA-forward uidA ATGTGCTGTGCCTGAACC 450 [60]
 uidA-reverse ATTGTTTGCCTCCCTGCTG   
Virulence genes for extra-intestinal pathogenic E. coli
 papC-forward papC GACGGCTGTACTGCAGGGTGTGGCG 350 [61]
 papC-reverse ATATCCTTTCTGCAGGGATGCAATA
 SfaSf sfaS GTGGATACGACGATTACTGTG 240 [62]
 SfaSr CCGCCAGCATTCCCTGTATTC
 Afaf afa/dra GGCAGAGGGCCGGCAACAGGC 592 [62]
 Afar CCCGTAACGCGCCAGCATCTC
 FyuAf fyuA TGATTAACCCCGCGACGGGAA 880 [62]
 FyuAr CGCAGTAGGCACGATGTTGTA
 yfcV-forward yfcV ACATGGAGACCACGTTCACC 292 [63]
 yfcV-reverse GTAATCTGGAATGTGGTCAGG
 Vat-forward vat TCAGGACACGTTCAGGCATTCAGT 1100 [63]
 Vat-reverse GGCCAGAACATTTGCTCCCTTGTT
 KpsMIIf kpsMT II GCGCATTTGCTGATACTGTTG 272 [62]
 KpsMIIr CATCCAGACGATAAGCATGAGCA
Quinolone resistance genes
 gyrA11753 gyrA GTATAACGCATTGCCGC 251 [64]
 gyrA12004 TGCCAGATGTCCGAGAT
 EC-PAR-A parC CTGAATGCCAGCGCCAAATT 189 [65]
 EC-PAR-B GCGAACGATTTCGGATCGTC
 qnrA-forward qnrA TCAGCAAGAGGATTTCTCA 605 [66]
 qnrA-reverse GGCAGCACTATTACTCCCA
 qnrB-forward qnrB GATCGTGAAAGCCAGAAAGG 469 [12]
 qnrB-reverse ACGATGCCTGGTAGTTGTCC
 qnrS-forward qnrS ACGACATTCGTCAACTGCAA 417 [12]
 qnrS-reverse TAAATTGGCACCCTGTAGGC
 qnrC-forward qnrC GGGTTGTACATTTATTGAATC 447 [64]
 qnrC-reverse TCCACTTTACGAGGTTCT
 qnrD-forward qnrD CGAGATCAATTTACGGGGAATA 582 [27]
 qnrD-reverse AACAAGCTGAAGCGCCTG
 qepA-forward qepA CTGCAGGTACTGCGTCATG 403 [67]
 qepA-reverse CGTGTTGCTGGAGTTCTTC
 aac-forward acc-(6′)-lb TTGCGATGCTCTATGAGTGGCTA 482 [26]
 aac-reverse CTCGAATGCCTGGCGTGTTT
Beta-lactamase resistant genes
 blaTEM-forward bla TEM GAGTATTCAACATTTTCGT 857 [30]
 blaTEM-reverse ACCAATGCTTAATCAGTGA
 blaSHV-forward bla SHV TCGCCTGTGTATTATCTCCC 768 [30]
 blaSHV-reverse CGCAGATAAATCACCACAATG
 blaOXA-1-forward bla OXA-1 GCAGCGCCAGTGCATCAAC 198 [30]
 blaOXA-1-reverse CCGCATCAAATGCCATAAGTG
 blaOXA-7-forward bla OXA-7, -9 AGTTCTCTGCCGAAGCC 591 [30]
 blaOXA-7-reverse TCTCAACCCAACCAACCC
 blaPSE-4-forward bla PSE-4 CTGCTCGTATAGGTGTTTCC 705 [30]
 blaPSE-4-reverse TCGCATCATTTCGCTCTTC
 blaCTX-M-3-f bla CTX-M-3 AATCACTGCGTCAGTTCAC 701 [30]
 blaCTX-M-3-r TTTATCCCCCACAACCCAG
 blaCTX-M-forward bla CTX-M AAGGCGTTTTGACAGACTATT 920 This study
 blaCTX-M-reverse GGTGACGATTTTAGCCGC