Skip to main content

Table 1 Primer sequences used in this study

From: Association of virulence gene expression with colistin-resistance in Acinetobacter baumannii: analysis of genotype, antimicrobial susceptibility, and biofilm formation

Primer name Sequence (5′–3′) Amplicon size (bp)
blsA-F ACCTTTAACCCGCTTTTGCT 117
blsA-R TCCCCTATTCACCATTCCAA
lpsB-F AGGCCATCAATCTTTGGTTG 137
lpsB-R GCTGACGTAATGGACGGATT
dnaK-F GCGTTTAATTGGTCGTCGTT 105
dnaK-R ACTTCAACCCAAGCATCACC
recA-F CACGCCCTAGACCCTCAATA 136
recA-R CGATTAAATCAATTGCGCCT
16srRNA-F AAAGTTGGTATTCGCAACGG 117
16srRNA-R ACCTTTAACCCGCTTTTGCT