Skip to main content

Table 1 Primers used for detection of antimicrobial resistant genes in Escherichia coli isolates

From: Molecular determination of antimicrobial resistance in Escherichia coli isolated from raw meat in Addis Ababa and Bishoftu, Ethiopia

Drug type Antimicrobial resistance genes Primers Sequence 5′–3′ Amplicon size (Bp) References
Streptomycin Adenylyl transferases (aadA1) aadA1F TATCCAGCTAAGCGCGAACT 447 [18]
aadA1R ATTTGCCGACTACCTTGGTC
Gentamicin Aminoglycoside acetyltransferases (aac(3)-IV) aac(3)-IVF CTTCAGGATGGCAAGTTGGT 286
aac(3)-IVR TCATCTCGTTCTCCGCTCAT
Sulfonamide Dihydropteroate synthase (sul1) sul1F TTCGGCATTCTGAATCTCAC 822
sul1R ATGATCTAACCCTCGGTCTC
Beta-lactams β-lactamase encoding penicillin resistance (bla SHV) bla SHVF TCGCCTGTGTATTATCTCCC 768
bla SHVR CGCAGATAAATCACCACAATG
β-lactamase encoding cephalosporin resistance (bla CMY) bla CMYF TGGCCAGAACTGACAGGCAAA 462
bla CMYR TTTCTCCTGAACGTGGCTGGC
Erythromycin Erythromycin esterase (ere(A)) ere(A)F GCCGGTGCTCATGAACTTGAG 419
ere(A)R CGACTCTATTCGATCAGAGGC
Chloramphenicol Acetyltransferases (catA1) catA1F AGTTGCTCAATGTACCTATAACC 547
catA1R TTGTAATTCATTAAGCATTCTGCC
Transporter resistance (cmlA) cmlAF CCGCCACGGTGTTGTTGTTATC 698
cmlAR CACCTTGCCTGCCCATCATTAG
Tetracycline Efflux pump resistance (tet(A)) tet(A)F GGTTCACTCGAACGACGTCA 577 [19]
tet(A)R CTGTCCGACAAGTTGCATGA  
\