Skip to main content

Table 1 Primers used to amplify ESBL resistance genes

From: Epidemiology of CTX-M-type extended-spectrum beta-lactamase (ESBL)-producing nosocomial -Escherichia coli infection in China

Target(s) Sequence
CTX-M group Ia GACGATGTCACTGGCTGAGC
AGCCGCCGACGCTAATACA
CTX-M group IIb GCGACCTGGTTAACTACAATCC
CGGTAGTATTGCCCTTAAGCC
CTX-M group IIIc CGCTTTGCCATGTGCAGCACC
GCTCAGTACGATCGAGCC
CTX-M group IVd GCTGGAGAAAAGCAGCGGAG
GTAAGCTGACGCAACGTCTG
CTX-M group Ve GCACGATGACATTCGGG
AACCCACGATGTGGGTAGC
TEM CATTTCCGTGTCGCCCTTATTC
CGTTCATCCATAGTTGCCTGAC
SHV AGCCGCTTGAGCAAATTAAAC
ATCCCGCAGATAAATCACCAC
OXAf GGCACCAGATTCAACTTTCAAG
GACCCCAAGTTTCCTGTAAGTG
VEB CATTTCCCGATGCAAAGCGT
CGAAGTTTCTTTGGACTCTG
PER GCTCCGATAATGAAAGCGT
TTCGGCTTGACTCGGCTGA
GES AGTCGGCTAGACCGGAAAG
TTTGTCCGTGCTCAGGAT
  1. aCTX-M-1, −3, −10 to −12, −15 (UOE-1), −22, −23, −28, −29, and −30.
  2. bCTX-M-2, −4 to −7, and −20 and Toho-1.
  3. cCTX-M-8.
  4. dCTX-M-9, −13, −14, −16 to −19 and −21, and −27 and Toho-2.
  5. eCTX-M-25 and −26.
  6. fOXA-1.