Skip to main content

Table 1 Primers and PCR conditions used to amplify resistance genes

From: Antimicrobial susceptibility and resistance mechanisms of methicillin resistant Staphylococcus aureusisolated from 12 Hospitals in Turkey

Resistance genes Primers PCR conditions References
ermA F 5′TCT AAA AAG CAT GTA AAA GAA3′ Pre cycle 93°C 3 min, [7] Sutcliffe 1996
R 5′CTT CGA TAG TTT ATT AAT ATT AGT3′ 35′cycles: 93°C 60 s, 52°C 60 s, 72°C 60 s
ermB F 5′GAA AAG GTA CTC AAC CAA ATA3′ Last cycle 72°C 5 min
R 5′AGT AAC GGT ACT TAA ATT GTT TAC3′
ermC F 5′GCT AAT ATT GTT TAA ATC GTC AAT TCC3′
R 5′GGA TCA GGA AAA GGA CAT TTT AC3′
msrA F 5′GCA AAT GGT GTA GGT AAG ACA ACT3′ Pre cycle 93°C 3 min, [7] Sutcliffe 1996
R 5′ATC ATG TGA TGT AAA CAA AAT3′ 35′cycles: 93°C 30 s, 52°C 30 s, 72°C 60 s
Last cycles 72°C 10 min
linA F 5′GTA TTA ACT GGA AAA CAG CAA AG3′ Pre cycle 5 dk 94°C [10] Lina 1999
R 5′GAG CTT CTT TTG AAA TAC ATG G3′ 35′cycles 45′s 94°C, 45′s 54°C,1 min at 72°C
linB F 5′CCTACCTATTGTTTGTGGAA 3′ Last cycle 5 min at 72°C [11] Bozdogan 1999
R 5′ATAACGTTACTCTCCTATTC 3′
tetM F 5′GTG GAC AAA GGT ACA ACG AG3′ Pre cycle 93oC’de 5 dk [9] Warsa 1996
R 5′CGG TAA AGT TCG TCA CAC AC3′ 35′cycles 93°C 60 s, 52°C 60 s, 72°C 60 s
tetK F 5′CAG CAG ATC CTA CTC CTT3′ Last cycle 10 min at 72°C
R 5′TCG ATA GGA ACA GCA GTA3′
aac-aph F 5′GAG CAA TAA GGG CAT ACC AAA AAT C3′ Pre cycle 94C’de 5 dk, [8] Kao 2000
R 5′CCG TGC ATT TGT CTT AAA AAA CTG G3′ 35′cycles 94°C 30 s, 50°C 30 s, 72°C 30 s
Last cycle 7 min at 72°C