Skip to main content

Table 1 The primer pairs used for amplification of OXA genes

From: Molecular characterisation and control of Acinetobacter baumanniiisolates resistant to multi-drugs emerging in inter-intensive care units

Primer 5′→3′ Amplicon size References
OXA-51 F: TAATGCTTTGATCGGCCTTG 353 22
R: TGGATTGCACTTCATCTTGG
OXA-23 F: GATCGGATTGGAGAACCAGA 501 22
R: ATTTCTGACCGCATTTCCAT
OXA-24 F: GGTTAGTTGGCCCCCTTAAA 246 22
R: AGTTGAGCGAAAAGGGGATT
OXA-58 F: AAGTATTGGGGCTTGTGCTG 599 22
R: CCCCTCTGCGCTCTACATAC
OXA-48 F:TTGGTGGCATCGATTATCGG 733 23
R:GAGCACTTCTTTTGTGATGGC