Skip to main content

Advertisement

Table 2 Primers used for the detection of carbapenemase genes.

From: Dissemination of multidrug resistant Acinetobacter baumannii in various hospitals of Antananarivo Madagascar

Name Sequence Use Experimental conditions Ref
AmpC 5'- ACTTACTTCAACTCGCGACG -3' 5'- TAAACACCACATATGTTCCG -3' blaampC Amplification Classical PCR (annealing temperature 44°C) [18]
OXA-51 5'- ATGAACATTAAAGCACTCTTAC -3' 5'- CTATAAAATACCTAATTGTTCT -3' blaOXA-51 Amplification Classical PCR (annealing temperature 50°C) [19]
OXA-23 5'- GCAAATAM AGAATATGTS CC -3' 5'- CTCM ACCCAR CCR GTCAACC -3' blaOXA-23 Amplification & sequencing Classical PCR (annealing temperature 58°C) [20]
OXA-24 5'- GGTTAGTTGGCCCCCTTAAA -3' 5'- AGTTGAGCGAAAAGGGGATT -3' blaOXA-24 Amplification Classical PCR (annealing temperature 59°C) [21]
VIM 5'- GTTTGGTCGCATATCGCAAC -3' 5'- CTACTCAACGACTGAGCGATTTGT -3' blaVIM Amplification Classical PCR (annealing temperature 60°C) [13]
IMP 5'- CTACCGCAGCAGAGTCTTTG -3' 5'- AACCAGTTTTGCCTTACCAT -3' blaIMP Classical PCR (annealing temperature 50°C) [13]
IsAba-1 F/OXA-23 R 5'- CACGAATGCAGAAGTTG - 3' 5'-TTAAATAATATTCAGCTGT - 3' Regulation of OXA-23 by IsAba- 1 Classical PCR (annealing temperature 50°C) [22]
REP 5'-IIIGCGCCGICATCAGGC-3' 5'-ACGTCTTATCAGGCCTAC-3 REP-PCR Amplification Classical PCR (annealing temperature 40°C) [23]