Skip to main content

Table 1 Details of the primers used for PCR protocols.

From: Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England

Primers sequences 5' to 3' amplicon size (bp)
Shv: CACTCAAGGATGTATTGTG, TTAGCGTTGCCAGTGC 885
Tem: TCGGGGAAATGTGCGCG, TGCTTAATCGTGAGGCACC 971
CatI: AGTTGCTCAATGTACCTATAACC, TTGTAATTCATTAAGCATTCTGCC 585
CatII: ACACTTTGCCCTTTATCGTC, TGAAAGCCATCACATACTGC 495
CatIII: TTCGCCGTGAGCATTTTG, TCGGATGAGTATGGGCAAC 508
cmlA: CCGCCACGGTGTTGTTGTTATC, CACCTTGCCTGCCCATCATTAG 698
tet B: TTGGTTAGGGGCAAGTTTTG, GTAATGGGCCAATAACACCG 659
tet C: CTTGAGAGCCTTCAACCCAG, ATGGTCCTCATCTACCTGCC 418
tet D: AAACCATTACGGCATTCTGC, GACCGGATACACCATCCATC 787
tet A: GCTACATCCTGCTTGCCTTC, CATAGATCGCCGTGAAGAGG 210
tet E: AAACCACATCCTCCATACGC, AAATAGGCCACAACCGTCAG 278
tetG: GCTCGGTGGTATCTCTGCTC, AGCAACAGAATCGGGAACAC 210
dfr1: ACGGATCCTGGCTGTTGGTTGGACGC, CGGAATTCACCTTCCGGCTCGATGTC 254
dfr9: ATGAATTCCCGTGGCATGAACCAGAAGAT, ATGGATCCTTCAGTAATGGTCGGGACCTC 399
dfrA7, dfrA17: GTCGCCCTAAAACAAAGTTA, CGCCCATAGAGTCAAATGT 195
dfr12, dfr13: CCGTGGGTCGATGTTTGATG, GCATTGGGAAGAAGGCGTTCAC 485
  1. Primer sequences and amplification protocols were taken from the following sources:: TEM & SHV β-lactamase genes [17];catI, catII, catIII [18]; cmlA [19];tetA, tetB, tetC, tetD, tetE and tetG [20];dfrA1, dfrA9 [21];dfrA12, dfrA13, dfrA7, dfrA17 [22]