Skip to main content

Table 1 PCR and sequencing primers

From: Mutation at the position 2058 of the 23S rRNA as a cause of macrolide resistance in Streptococcus pyogenes

Primer Target gene Position Use Sequence (5'-3') Reference
23Scom a 23S rRNA 6-26b PCR/Seq AGTTAATAAGGGCGCACGGTG This work
23Sg1 c 23S rRNA gene1 1577119-157741d PCR/Seq AAGACGTATTGAAGCTTACTCTA This work
23Sg2 c 23S rRNA gene2 22879-22857 d PCR/Seq AGCTACTTCCCGAACTGATGCAC This work
23Sg3 c 23S rRNA gene3 29128-29106 d PCR/Seq GATAACCGTCTTCTTTCCCCTTT This work
23Sg4 c 23S rRNA gene4 85192-85170 d PCR/Seq CATATTTCTAACACGGGCAGTAG This work
23Sg5 c 23S rRNA gene5 270607-270582 d PCR/Seq CACTGCCAAGCTATCTAAACGTA This work
23Sg6 c 23S rRNA gene6 1330037-1330059d PCR/Seq CAATTGAATAGCCTGCACGTTCG This work
MS2 e 23S rRNA 550-573b Sequencing CGTGTGCCTACAACAAGTTCGAGC This work
MS3 e 23S rRNA 573-550b Sequencing GCTCGAACTTGTTGTAGGCACACG This work
MS4 e 23S rRNA 1016-997b Sequencing TTTCGACTACGGATCTTAGC [11]
MS5 e 23S rRNA 867-885b Sequencing CTGTTTGGGTGAGGGGTCC [11]
MS6 e 23S rRNA 1424-1446b Sequencing GGACGCAGTAGGCTAACTAAACC This work
MS7 e 23S rRNA 1446-1424b Sequencing GCTTTAGTTAGCCTACTGCGTCC This work
MS8 e 23S rRNA 2021-2040b Sequencing ACCTGCATCTTCACAGGTAC [11]
MS9 e 23S rRNA 1902-1921b Sequencing CGGCGGCCGTAACTATAACG [11]
MS10 e 23S rRNA 2415-2437b Sequencing GCCATCGCTCAACGGATAAAAGC This work
MS11 e 23S rRNA 2437-2415b Sequencing GCTTTTATCCGTTGAGCGATGGC This work
MS12 e 23S rRNA 2904-2880b Sequencing TTGGATAAGTCCTCGAGCTATTAG [11]
L4fu L4 64481-64498c PCR/Seq GCAAACACAGCTCCTAAG This work
L4rd L4 65751-65734c PCR/Seq CTGTGTAACGACCAACGC This work
L4f156 L4 65074-65091c Sequencing AACCGTTCAGCAGTATCA This work
L4r444 L4 65307-65290c Sequencing TGAAAGGCCTTCTACAGC This work
L22-1 L22 67079-67098c PCR/Seq GCAGACGACAAGAAAACACG [11]
L22-2 L22 67500-67481c PCR/Seq ATTGGATGTACTTTTTGACC [11]
  1. a A PCR primer common to all 23S rRNA genes b Position in the 23S rRNA molecule (E. coli accession number J01695, numbering). c rRNA operon spesific PCR primers, artificial numbering of the 23S rRNA genes of the S. pyogenes d Position in the S. pyogenes genome (accession number AE004092). e23S rRNA gene sequencing primers