Skip to main content

Table 1 PCR primer pairs for directional cloning of the aadA2 and linF genes

From: Prevalence and characterization of integrons in blood culture Enterobacteriaceae and gastrointestinal Escherichia coli in Norway and reporting of a novel class 1 integron-located lincosamide resistance gene

Primer Sequence (5'-3')
LinF-topo-F CACCATGCTTCAGCAGAAAATGATC
LinF-topo-R TTACTTGTTGTGCGGCGTC
AadA2-topo-F CACCATGAGGGTAGCGGTGACCATC
AadA2-topo-R TCATTTACCAACTGACTTGATG