Skip to main content

Table 1 Primers and probes used in duplex real-time PCR

From: The establishment of a duplex real-time PCR assay for rapid and simultaneous detection of blaNDM and blaKPC genes in bacteria

Target Primer/probe name Sequence(5’-3’) Position Amplicon size (bp)
bla NDM NDM-F TTGGCGATCTGGTTTTCC 137–154 195
NDM-R GGTTGATCTCCTGCTTGA 331–314
NDM-probe JOE-TGGCAGCACACTTCCTATCTCG- ECLIPSE 175–196
bla KPC KPC-F CGCAACTGTAAGTTACCG 162–179 187
KPC-R CATGCCTGTTGTCAGATA 348–331
KPC-probe FAM –CCACTGTGCAGCTCATTCAAGG - ECLIPSE 196-217