Skip to main content

Table 2 PCR and DNA primers sequencing of the three ESBL genetic markers

From: Detection of new SHV-12, SHV-5 and SHV-2a variants of extended spectrum Beta-lactamase in Klebsiella pneumoniae in Egypt

Primer Sequence Size (bp) Reference
Core TEM F CAGCGGTAAGATCCTTGAGA 643 [9]
Core TEM R ACTCCCCGTCGTGTAGATAA
Core SHV F GGCCGCGTAGGCATGATAGA 714
Core SHV R CCCGGCGATTTGCTGATTTC
Core CTXM F AACCGTCACGCTGTTGTTAG 766
Core CTXM R TTGAGGCGTGGTGAAGTAAG
Upstream TEM F Upstream TEM R TGAAGACGAAAGGGCCTCCTG ACTCCCCGTCGTGTAGATAA 109 Newly designed primers in GDDRP Molecular Laboratoryfor this study
Upstream SHV F Upstream SHV R CGTTWTDTTCGCCKGTGT CGAGTAGTCCACCAGATCCTG 74
Upstream XTXM-F Upstream CXTXM-R ATGGTTAAAAAATCACTG ACGTTATCGCTGTACTGTA 55
Downstream TEM F Downstream TEM R CAGCGGTAAGATCCTTGAGA TAATCAGTGAGGCACCTATCTC 109
Downstream SHV F Downstream SHV R GGCCGCGTAGGCATGATAGA CCCGGCGATTTGCTGATTTC 74
Downstream CTXM-F Downstream CTXM-R TACAGTACAGCGATAACGTGG CCGTTTCCGCTATTACAAA 55