Skip to main content

Advertisement

Table 1 Primers used in this study

From: Use of tuf as a target for sequence-based identification of Gram-positive cocci of the genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus

Primers Sequence (5_ to 3_) Gene Primers from
Tuf-F 5- CCAATGCCACAAACTCGT -3 tuf This study
Tuf-R 5- CCTGAACCAACAGTACGT -3   
D1 5-CCITAYICITAYGAYGCIYTIGARCC-3 sodA reference [35, 36]
D2 5-ARRTARTAIGCRTGYTCCCAIACRTC-3   
dnaK-F 5CTTGGTGGTGACGACTTTGAC -3 dnaK This study
dnaK-R 5CCACCCATTGTTTCGATACCA-3   
16s F 5AGAGTTTGATCCTGGCTCAG-3 16S RNA Reference [37]
16s R 5AAAGGAGGTGATCCAGCC-3