Skip to main content

Table 1 Oligonucleotide primers

From: Virulence profile of different phylogenetic groups of locally isolated community acquired uropathogenic E. coli from Faisalabad region of Pakistan

Genes Primer sequences (5/to 3/) Amplicon size (bp) References
chuA GACGAACCAACGGTCAGGAT 279 [2]
  TGCCGCCAGTACCAAAGACA   
yjaA TGAAGTGTCAGGAGACGCTG 211 [2]
  ATGGAGAATGCGTTCCTCAAC   
TspE4.C2 GAGTAATGTCGGGGCATTCA 152 [2]
  CGCGCCAACAAAGTATTACG    
uidA ATCACCGTGGTGACGCATGTCGC 486 [18]
  CACCACGATGCCAT GTTCATCTGC   
cnf1 GGCGACAAATGCAGTATTGCTTGG 552 [19]
  GACGTTGGTTGCGGTAATTTTGGG   
papC GACGGCTGTACTGCAGGGTGTGGCG 328 [20]
  ATATCCTTTCTGCAGGGATGCAATA   
sfaDE CTCCGGAGAACTGGGTGCATCTTAC 408 [20]
  CGGAGGAGTAATTACAAACCTGGCA   
afaBC3 CATCAAGCTGTTTGTTCGTCCGCCG 793 [20]
  GCTGGGCAGCAAACTGATAACTCTC   
eaeA GACCCGGCACAAGCATAAGC 384 [21]
  CCACCTGCAGCAACAAGAGG